Incidental Mutation 'R7442:Zfhx3'
ID577026
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Namezinc finger homeobox 3
SynonymsA230102L03Rik, Atbf1, WBP9
MMRRC Submission
Accession Numbers

Genbank: NM_007496

Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location107942644-108961630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108792836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 197 (T197A)
Ref Sequence ENSEMBL: ENSMUSP00000044612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000188994] [ENSMUST00000220518]
Predicted Effect probably damaging
Transcript: ENSMUST00000043896
AA Change: T197A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: T197A

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188994
Predicted Effect probably damaging
Transcript: ENSMUST00000220518
AA Change: T197A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 108793594 missense probably benign 0.00
IGL01946:Zfhx3 APN 8 108933929 missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 108947193 missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 108947234 missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 108793883 missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 108955742 missense unknown
IGL02406:Zfhx3 APN 8 108955742 missense unknown
IGL02408:Zfhx3 APN 8 108955372 splice site probably benign
IGL02549:Zfhx3 APN 8 108800509 missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 108856830 missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 108793535 missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 108793188 missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 108794727 missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 108946550 missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 108956094 small insertion probably benign
FR4589:Zfhx3 UTSW 8 108956101 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956088 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956102 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956103 small insertion probably benign
G5030:Zfhx3 UTSW 8 108951459 missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 108950178 missense probably benign 0.02
R0090:Zfhx3 UTSW 8 108950057 missense possibly damaging 0.85
R0330:Zfhx3 UTSW 8 108948957 missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 108946623 missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 108951246 missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 108800509 missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 108794187 missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 108948539 missense probably benign 0.03
R0614:Zfhx3 UTSW 8 108948967 nonsense probably null
R0653:Zfhx3 UTSW 8 108946808 missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 108955650 missense unknown
R0825:Zfhx3 UTSW 8 108949208 missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 108794411 missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 108933833 missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 108800698 splice site probably benign
R1412:Zfhx3 UTSW 8 108914567 missense possibly damaging 0.88
R1447:Zfhx3 UTSW 8 108948444 missense probably benign 0.03
R1530:Zfhx3 UTSW 8 108948489 missense probably damaging 1.00
R1745:Zfhx3 UTSW 8 108955862 missense unknown
R1764:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R1781:Zfhx3 UTSW 8 108793535 missense probably benign 0.01
R1917:Zfhx3 UTSW 8 108956248 missense unknown
R1956:Zfhx3 UTSW 8 108794142 missense probably benign 0.02
R2049:Zfhx3 UTSW 8 108945177 missense probably benign 0.01
R2196:Zfhx3 UTSW 8 108800253 missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 108956032 missense unknown
R3765:Zfhx3 UTSW 8 108792762 missense probably damaging 0.97
R4162:Zfhx3 UTSW 8 108956987 missense unknown
R4243:Zfhx3 UTSW 8 108792320 missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 108956390 missense unknown
R4433:Zfhx3 UTSW 8 108955637 missense unknown
R4509:Zfhx3 UTSW 8 108793779 missense probably benign 0.01
R4731:Zfhx3 UTSW 8 108956084 missense unknown
R4788:Zfhx3 UTSW 8 108794210 missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 108947961 missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 108957007 missense unknown
R4907:Zfhx3 UTSW 8 108793354 missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 108947850 missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 108948317 missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 108800575 missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 108951185 missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 108946814 missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 108792399 missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 108956210 missense unknown
R5541:Zfhx3 UTSW 8 108948951 missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 108955991 missense unknown
R5700:Zfhx3 UTSW 8 108933867 missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 108800332 missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 108793446 missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 108946698 missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 108950851 missense possibly damaging 0.91
R6020:Zfhx3 UTSW 8 108792527 missense probably damaging 1.00
R6028:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 108947421 missense probably benign 0.04
R6253:Zfhx3 UTSW 8 108955388 missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 108946619 missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 108949517 missense probably benign 0.20
R6829:Zfhx3 UTSW 8 108950283 missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 108800528 missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 108951392 missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 108956821 missense unknown
R6927:Zfhx3 UTSW 8 108956821 missense unknown
R7152:Zfhx3 UTSW 8 108948207 missense possibly damaging 0.94
R7169:Zfhx3 UTSW 8 108951398 missense possibly damaging 0.86
R7214:Zfhx3 UTSW 8 108948861 missense probably damaging 0.98
R7378:Zfhx3 UTSW 8 108793248 missense probably damaging 0.99
R7391:Zfhx3 UTSW 8 108947843 missense probably damaging 0.96
R7636:Zfhx3 UTSW 8 108946809 missense probably benign 0.25
R7649:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R7728:Zfhx3 UTSW 8 108951569 missense probably benign 0.01
R7780:Zfhx3 UTSW 8 108951651 missense possibly damaging 0.53
R7904:Zfhx3 UTSW 8 108951063 missense probably damaging 0.98
R7987:Zfhx3 UTSW 8 108951063 missense probably damaging 0.98
R8032:Zfhx3 UTSW 8 108951222 missense possibly damaging 0.51
R8158:Zfhx3 UTSW 8 108948721 missense possibly damaging 0.82
RF027:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF028:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF029:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF031:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF032:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF037:Zfhx3 UTSW 8 108956098 nonsense probably null
RF038:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF040:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956088 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF054:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF060:Zfhx3 UTSW 8 108956088 small insertion probably benign
X0019:Zfhx3 UTSW 8 108951653 missense probably benign 0.00
X0026:Zfhx3 UTSW 8 108949145 missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 108951357 missense possibly damaging 0.72
Z1176:Zfhx3 UTSW 8 108793923 missense probably benign 0.09
Z1176:Zfhx3 UTSW 8 108800449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCGCGTACATTGTTGAG -3'
(R):5'- AAAGCCATCGAATTTGGACAGGTC -3'

Sequencing Primer
(F):5'- ACATTGTTGAGAGCCTGAGCC -3'
(R):5'- CAGGTCCACATTGTTGGGAACATC -3'
Posted On2019-10-07