Incidental Mutation 'R7442:Ptprk'
ID577030
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28574819 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 992 (G992D)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: G978D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: G978D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: G992D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: G966D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGTGGCAGGGATAAACACC -3'
(R):5'- GGATGATCTTTTCCAAGACAGTTG -3'

Sequencing Primer
(F):5'- CAGGGATAAACACCTTAGAAAGTATG -3'
(R):5'- CCAAGACAGTTGATTATTATTCTCA -3'
Posted On2019-10-07