Incidental Mutation 'R7442:Setdb2'
ID 577045
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 045518-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R7442 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59656700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 206 (F206L)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: F222L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: F222L

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: F206L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: F206L

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,946,919 (GRCm39) I109T probably damaging Het
A430033K04Rik T C 5: 138,645,509 (GRCm39) S465P possibly damaging Het
Acap3 T C 4: 155,990,078 (GRCm39) F753L probably damaging Het
Adam9 A T 8: 25,457,223 (GRCm39) V635E probably damaging Het
Adgre4 T A 17: 56,159,340 (GRCm39) V675E probably benign Het
Anapc4 T C 5: 53,014,543 (GRCm39) Y469H probably benign Het
Ankdd1b T G 13: 96,561,268 (GRCm39) K325N possibly damaging Het
Aox1 T C 1: 58,121,172 (GRCm39) V881A probably damaging Het
Arhgap5 A G 12: 52,563,739 (GRCm39) T237A probably benign Het
Asah1 T C 8: 41,796,602 (GRCm39) D331G possibly damaging Het
Atp5f1a G A 18: 77,866,820 (GRCm39) R231H probably benign Het
Bod1l G A 5: 41,964,522 (GRCm39) P2694L probably damaging Het
Bst1 T C 5: 43,979,084 (GRCm39) S143P probably benign Het
Cacna1b A C 2: 24,497,513 (GRCm39) S2132A probably benign Het
Caps2 G T 10: 112,044,259 (GRCm39) R486L probably damaging Het
Ccdc168 A G 1: 44,097,868 (GRCm39) S1077P possibly damaging Het
Cd68 T C 11: 69,556,754 (GRCm39) T18A probably benign Het
Cdk8 T C 5: 146,229,579 (GRCm39) probably null Het
Col18a1 A T 10: 76,932,072 (GRCm39) I127N unknown Het
Dsc3 T C 18: 20,114,213 (GRCm39) D347G probably damaging Het
Dyrk2 T C 10: 118,695,786 (GRCm39) S491G probably damaging Het
Edem1 T A 6: 108,828,266 (GRCm39) Y530* probably null Het
Enc1 A T 13: 97,383,248 (GRCm39) H586L probably benign Het
Ephb6 T G 6: 41,594,981 (GRCm39) probably null Het
Etv5 G T 16: 22,254,809 (GRCm39) Q48K probably damaging Het
Exoc3l A G 8: 106,019,558 (GRCm39) W404R probably damaging Het
Fbn1 C A 2: 125,245,132 (GRCm39) A252S possibly damaging Het
Foxe3 A G 4: 114,782,490 (GRCm39) S241P unknown Het
Gm49380 T A 9: 44,023,709 (GRCm39) M180L probably benign Het
Hoxd1 A T 2: 74,593,903 (GRCm39) D153V probably damaging Het
Ifi207 C T 1: 173,554,997 (GRCm39) S895N probably benign Het
Igf1r G A 7: 67,823,026 (GRCm39) V385M probably damaging Het
Ints9 C T 14: 65,232,513 (GRCm39) Q191* probably null Het
Ktn1 A G 14: 47,952,097 (GRCm39) E979G probably benign Het
Lama3 G A 18: 12,605,238 (GRCm39) probably null Het
Lrtm2 C T 6: 119,294,392 (GRCm39) M246I probably damaging Het
Mdm1 T C 10: 117,982,590 (GRCm39) V75A probably benign Het
Mia3 T C 1: 183,140,220 (GRCm39) E165G probably benign Het
Mrps21 T C 3: 95,770,128 (GRCm39) E67G probably damaging Het
Mybpc1 A C 10: 88,362,155 (GRCm39) I995S probably damaging Het
Mylk2 T G 2: 152,753,346 (GRCm39) probably benign Het
Myo16 G A 8: 10,322,537 (GRCm39) C11Y probably damaging Het
Nudt18 A C 14: 70,816,798 (GRCm39) D134A probably benign Het
Obox1 G T 7: 15,289,491 (GRCm39) K93N probably benign Het
Or12d2 T A 17: 37,624,816 (GRCm39) H153L possibly damaging Het
Or2r3 A T 6: 42,448,434 (GRCm39) M226K probably benign Het
Or56a4 T C 7: 104,806,289 (GRCm39) Y200C probably damaging Het
Or5ar1 A T 2: 85,672,096 (GRCm39) V13D probably benign Het
Pkd2l1 T C 19: 44,145,668 (GRCm39) H185R probably benign Het
Ptpn18 A G 1: 34,501,831 (GRCm39) T48A probably benign Het
Ptprd A T 4: 75,978,058 (GRCm39) Y583* probably null Het
Ptprk G A 10: 28,450,815 (GRCm39) G992D probably damaging Het
Slain1 A G 14: 103,923,150 (GRCm39) D247G probably damaging Het
Slc10a2 A T 8: 5,139,086 (GRCm39) V286E possibly damaging Het
Slc44a2 C T 9: 21,256,819 (GRCm39) T367I probably damaging Het
Slco4a1 T C 2: 180,115,919 (GRCm39) V685A probably benign Het
Srp54c T A 12: 55,302,347 (GRCm39) Y333N probably damaging Het
Srrm2 T C 17: 24,039,091 (GRCm39) S1912P unknown Het
St7l A G 3: 104,796,645 (GRCm39) T253A possibly damaging Het
Styxl2 T C 1: 165,928,584 (GRCm39) K343E probably benign Het
Sun3 T G 11: 8,981,445 (GRCm39) Y53S possibly damaging Het
Tktl2 A G 8: 66,965,561 (GRCm39) N373S possibly damaging Het
Tmco3 T A 8: 13,370,781 (GRCm39) S648R probably damaging Het
Tmem178 T A 17: 81,252,185 (GRCm39) V23D probably damaging Het
Tmem229a C A 6: 24,955,689 (GRCm39) G22W probably damaging Het
Top3a C T 11: 60,644,744 (GRCm39) S320N possibly damaging Het
Treml1 C A 17: 48,673,719 (GRCm39) D243E probably damaging Het
Trim42 C T 9: 97,244,998 (GRCm39) V601M probably damaging Het
Ttn A G 2: 76,573,350 (GRCm39) S25848P probably damaging Het
Vmn1r86 A T 7: 12,835,983 (GRCm39) F298I possibly damaging Het
Vmn2r96 T C 17: 18,793,662 (GRCm39) F2S probably benign Het
Xpc A G 6: 91,481,631 (GRCm39) L230P probably damaging Het
Xpo4 A G 14: 57,867,680 (GRCm39) V189A probably benign Het
Zfhx3 A G 8: 109,519,468 (GRCm39) T197A probably damaging Het
Zswim1 A G 2: 164,667,710 (GRCm39) K321E probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59,663,943 (GRCm39) missense probably null 0.00
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGGCCATACTGTATTTC -3'
(R):5'- CCATATCTGCTCCAGGACTTG -3'

Sequencing Primer
(F):5'- CGGGGCCATACTGTATTTCTATAC -3'
(R):5'- GCTCCAGGACTTGTCTAATGGAAAC -3'
Posted On 2019-10-07