Mutagenetix > Incidental Mutation

Incidental Mutation 'R7442:Setdb2'

577045

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R7442 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59419251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 206 (F206L)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: F222L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: F222L

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253

Predicted Effect

probably damaging
Transcript: ENSMUST00000161459
AA Change: F206L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: F206L

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,220,290	I109T	probably damaging	Het
A430033K04Rik	T	C	5: 138,647,247	S465P	possibly damaging	Het
Acap3	T	C	4: 155,905,621	F753L	probably damaging	Het
Adam9	A	T	8: 24,967,207	V635E	probably damaging	Het
Adgre4	T	A	17: 55,852,340	V675E	probably benign	Het
Anapc4	T	C	5: 52,857,201	Y469H	probably benign	Het
Ankdd1b	T	G	13: 96,424,760	K325N	possibly damaging	Het
Aox1	T	C	1: 58,082,013	V881A	probably damaging	Het
Arhgap5	A	G	12: 52,516,956	T237A	probably benign	Het
Asah1	T	C	8: 41,343,565	D331G	possibly damaging	Het
Atp5a1	G	A	18: 77,779,120	R231H	probably benign	Het
Bod1l	G	A	5: 41,807,179	P2694L	probably damaging	Het
Bst1	T	C	5: 43,821,742	S143P	probably benign	Het
Cacna1b	A	C	2: 24,607,501	S2132A	probably benign	Het
Caps2	G	T	10: 112,208,354	R486L	probably damaging	Het
Cd68	T	C	11: 69,665,928	T18A	probably benign	Het
Cdk8	T	C	5: 146,292,769		probably null	Het
Col18a1	A	T	10: 77,096,238	I127N	unknown	Het
Dsc3	T	C	18: 19,981,156	D347G	probably damaging	Het
Dusp27	T	C	1: 166,101,015	K343E	probably benign	Het
Dyrk2	T	C	10: 118,859,881	S491G	probably damaging	Het
Edem1	T	A	6: 108,851,305	Y530*	probably null	Het
Enc1	A	T	13: 97,246,740	H586L	probably benign	Het
Ephb6	T	G	6: 41,618,047		probably null	Het
Etv5	G	T	16: 22,436,059	Q48K	probably damaging	Het
Exoc3l	A	G	8: 105,292,926	W404R	probably damaging	Het
Fbn1	C	A	2: 125,403,212	A252S	possibly damaging	Het
Foxe3	A	G	4: 114,925,293	S241P	unknown	Het
Gm49380	T	A	9: 44,112,412	M180L	probably benign	Het
Gm8251	A	G	1: 44,058,708	S1077P	possibly damaging	Het
Hoxd1	A	T	2: 74,763,559	D153V	probably damaging	Het
Ifi207	C	T	1: 173,727,431	S895N	probably benign	Het
Igf1r	G	A	7: 68,173,278	V385M	probably damaging	Het
Ints9	C	T	14: 64,995,064	Q191*	probably null	Het
Ktn1	A	G	14: 47,714,640	E979G	probably benign	Het
Lama3	G	A	18: 12,472,181		probably null	Het
Lrtm2	C	T	6: 119,317,431	M246I	probably damaging	Het
Mdm1	T	C	10: 118,146,685	V75A	probably benign	Het
Mia3	T	C	1: 183,358,876	E165G	probably benign	Het
Mrps21	T	C	3: 95,862,816	E67G	probably damaging	Het
Mybpc1	A	C	10: 88,526,293	I995S	probably damaging	Het
Mylk2	T	G	2: 152,911,426		probably benign	Het
Myo16	G	A	8: 10,272,537	C11Y	probably damaging	Het
Nudt18	A	C	14: 70,579,358	D134A	probably benign	Het
Obox1	G	T	7: 15,555,566	K93N	probably benign	Het
Olfr1019	A	T	2: 85,841,752	V13D	probably benign	Het
Olfr102	T	A	17: 37,313,925	H153L	possibly damaging	Het
Olfr457	A	T	6: 42,471,500	M226K	probably benign	Het
Olfr684	T	C	7: 105,157,082	Y200C	probably damaging	Het
Pkd2l1	T	C	19: 44,157,229	H185R	probably benign	Het
Ptpn18	A	G	1: 34,462,750	T48A	probably benign	Het
Ptprd	A	T	4: 76,059,821	Y583*	probably null	Het
Ptprk	G	A	10: 28,574,819	G992D	probably damaging	Het
Slain1	A	G	14: 103,685,714	D247G	probably damaging	Het
Slc10a2	A	T	8: 5,089,086	V286E	possibly damaging	Het
Slc44a2	C	T	9: 21,345,523	T367I	probably damaging	Het
Slco4a1	T	C	2: 180,474,126	V685A	probably benign	Het
Srp54c	T	A	12: 55,255,562	Y333N	probably damaging	Het
Srrm2	T	C	17: 23,820,117	S1912P	unknown	Het
St7l	A	G	3: 104,889,329	T253A	possibly damaging	Het
Sun3	T	G	11: 9,031,445	Y53S	possibly damaging	Het
Tktl2	A	G	8: 66,512,909	N373S	possibly damaging	Het
Tmco3	T	A	8: 13,320,781	S648R	probably damaging	Het
Tmem178	T	A	17: 80,944,756	V23D	probably damaging	Het
Tmem229a	C	A	6: 24,955,690	G22W	probably damaging	Het
Top3a	C	T	11: 60,753,918	S320N	possibly damaging	Het
Treml1	C	A	17: 48,366,691	D243E	probably damaging	Het
Trim42	C	T	9: 97,362,945	V601M	probably damaging	Het
Ttn	A	G	2: 76,743,006	S25848P	probably damaging	Het
Vmn1r86	A	T	7: 13,102,056	F298I	possibly damaging	Het
Vmn2r96	T	C	17: 18,573,400	F2S	probably benign	Het
Xpc	A	G	6: 91,504,649	L230P	probably damaging	Het
Xpo4	A	G	14: 57,630,223	V189A	probably benign	Het
Zfhx3	A	G	8: 108,792,836	T197A	probably damaging	Het
Zswim1	A	G	2: 164,825,790	K321E	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGGGCCATACTGTATTTC -3'
(R):5'- CCATATCTGCTCCAGGACTTG -3'

Sequencing Primer
(F):5'- CGGGGCCATACTGTATTTCTATAC -3'
(R):5'- GCTCCAGGACTTGTCTAATGGAAAC -3'

Posted On

2019-10-07