Incidental Mutation 'R7442:Ints9'
ID577046
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Nameintegrator complex subunit 9
SynonymsD14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64950045-65039832 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 64995064 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 191 (Q191*)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
Predicted Effect probably null
Transcript: ENSMUST00000043914
AA Change: Q191*
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: Q191*

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCATGAGACAGGCTAGTGAAAAG -3'
(R):5'- TTTAGACAGTCCTGGCAAGC -3'

Sequencing Primer
(F):5'- CTAGTGAAAAGGGGGCAAATCCAC -3'
(R):5'- CTGAGTGACCTGGACCATTAGAC -3'
Posted On2019-10-07