Incidental Mutation 'R7442:Olfr102'
ID 577052
Institutional Source Beutler Lab
Gene Symbol Olfr102
Ensembl Gene ENSMUSG00000091531
Gene Name olfactory receptor 102
Synonyms MOR250-4, GA_x6K02T2PSCP-1775063-1774137
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7442 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37311795-37317054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37313925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 153 (H153L)
Ref Sequence ENSEMBL: ENSMUSP00000149168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169373] [ENSMUST00000217590]
AlphaFold B2RT33
Predicted Effect possibly damaging
Transcript: ENSMUST00000169373
AA Change: H153L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126737
Gene: ENSMUSG00000091531
AA Change: H153L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.6e-52 PFAM
Pfam:7tm_1 39 289 8.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217590
AA Change: H153L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Olfr102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr102 APN 17 37313707 missense possibly damaging 0.90
IGL01947:Olfr102 APN 17 37313665 missense probably damaging 1.00
IGL02164:Olfr102 APN 17 37313687 missense probably benign 0.01
IGL02465:Olfr102 APN 17 37313911 missense probably damaging 0.99
IGL03095:Olfr102 APN 17 37313773 missense probably benign 0.01
R0712:Olfr102 UTSW 17 37314084 missense probably damaging 0.96
R1572:Olfr102 UTSW 17 37313480 missense probably benign
R1749:Olfr102 UTSW 17 37314061 missense probably benign 0.05
R3083:Olfr102 UTSW 17 37314195 missense probably damaging 1.00
R4022:Olfr102 UTSW 17 37314274 missense probably benign
R5203:Olfr102 UTSW 17 37314201 missense probably damaging 1.00
R5367:Olfr102 UTSW 17 37314256 missense probably damaging 1.00
R5387:Olfr102 UTSW 17 37314292 missense probably benign 0.22
R5488:Olfr102 UTSW 17 37313668 missense probably damaging 1.00
R6804:Olfr102 UTSW 17 37314130 missense probably damaging 1.00
R7473:Olfr102 UTSW 17 37313631 missense probably benign 0.03
R8110:Olfr102 UTSW 17 37313713 missense probably benign 0.00
R8887:Olfr102 UTSW 17 37313751 missense probably damaging 1.00
R9400:Olfr102 UTSW 17 37313663 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGCTGCAAGAACGAGTC -3'
(R):5'- TGGGATGCATAACTCAGCTCC -3'

Sequencing Primer
(F):5'- TCTTGAGGAAAAGATAGGTGATGATG -3'
(R):5'- GGGATGCATAACTCAGCTCCATTTC -3'
Posted On 2019-10-07