Incidental Mutation 'R7442:Atp5a1'
ID577058
Institutional Source Beutler Lab
Gene Symbol Atp5a1
Ensembl Gene ENSMUSG00000025428
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
SynonymsAtpm, Mom2, D18Ertd206e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77773729-77782869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77779120 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 231 (R231H)
Ref Sequence ENSEMBL: ENSMUSP00000026495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]
Predicted Effect probably benign
Transcript: ENSMUST00000026495
AA Change: R231H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428
AA Change: R231H

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:ATP-synt_ab_N 67 135 3.4e-17 PFAM
Pfam:ATP-synt_ab 192 415 5.7e-76 PFAM
Pfam:ATP-synt_ab_C 427 528 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114748
AA Change: R181H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428
AA Change: R181H

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 17 85 1.1e-19 PFAM
Pfam:ATP-synt_ab 141 365 4.8e-75 PFAM
Pfam:ATP-synt_ab_C 377 479 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135678
SMART Domains Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
PDB:2W6J|C 22 78 5e-27 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Atp5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Atp5a1 APN 18 77777533 missense probably damaging 1.00
IGL01536:Atp5a1 APN 18 77780312 intron probably benign
IGL01585:Atp5a1 APN 18 77781058 missense possibly damaging 0.95
IGL02973:Atp5a1 APN 18 77780149 missense probably damaging 1.00
R0268:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0344:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0399:Atp5a1 UTSW 18 77781836 nonsense probably null
R0464:Atp5a1 UTSW 18 77779922 missense probably benign 0.04
R1471:Atp5a1 UTSW 18 77781269 missense probably damaging 1.00
R1476:Atp5a1 UTSW 18 77781925 missense probably benign 0.00
R1630:Atp5a1 UTSW 18 77777567 missense possibly damaging 0.94
R2102:Atp5a1 UTSW 18 77782317 missense probably damaging 0.99
R4424:Atp5a1 UTSW 18 77780066 intron probably benign
R4746:Atp5a1 UTSW 18 77778742 missense probably benign 0.00
R4864:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R5191:Atp5a1 UTSW 18 77780229 missense probably damaging 1.00
R6217:Atp5a1 UTSW 18 77781356 missense probably benign
R6262:Atp5a1 UTSW 18 77781212 missense probably damaging 1.00
R6263:Atp5a1 UTSW 18 77779230 splice site probably null
R6284:Atp5a1 UTSW 18 77778468 missense probably benign 0.30
R6873:Atp5a1 UTSW 18 77775840 nonsense probably null
R7661:Atp5a1 UTSW 18 77774102 missense possibly damaging 0.70
R7696:Atp5a1 UTSW 18 77780986 missense probably damaging 1.00
R7846:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R7929:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
X0021:Atp5a1 UTSW 18 77781273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAGACTGGGTAATGACTC -3'
(R):5'- TTAGGCAGAGGCTGTTCCAAG -3'

Sequencing Primer
(F):5'- CAGACTGGGTAATGACTCAAAATCTG -3'
(R):5'- GCAGAGGCTGTTCCAAGATTATC -3'
Posted On2019-10-07