Incidental Mutation 'R7443:Sox13'
ID577063
Institutional Source Beutler Lab
Gene Symbol Sox13
Ensembl Gene ENSMUSG00000070643
Gene NameSRY (sex determining region Y)-box 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133382303-133424377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133384631 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 465 (Y465C)
Ref Sequence ENSEMBL: ENSMUSP00000092130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094551] [ENSMUST00000129213] [ENSMUST00000135222] [ENSMUST00000144386] [ENSMUST00000153799]
Predicted Effect probably damaging
Transcript: ENSMUST00000094551
AA Change: Y465C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092130
Gene: ENSMUSG00000070643
AA Change: Y465C

DomainStartEndE-ValueType
coiled coil region 171 217 N/A INTRINSIC
HMG 415 485 3.09e-27 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129213
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135222
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144386
AA Change: Y446C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122980
Gene: ENSMUSG00000070643
AA Change: Y446C

DomainStartEndE-ValueType
coiled coil region 153 197 N/A INTRINSIC
HMG 396 466 3.09e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153799
AA Change: Y465C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119729
Gene: ENSMUSG00000070643
AA Change: Y465C

DomainStartEndE-ValueType
coiled coil region 153 199 N/A INTRINSIC
HMG 397 467 3.09e-27 SMART
low complexity region 575 589 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. It has also been determined to be a type-1 diabetes autoantigen, also known as islet cell antibody 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired development of gamma-delta T cells and severe postnatal growth defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Sox13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sox13 APN 1 133387106 missense probably benign 0.02
IGL01147:Sox13 APN 1 133393135 missense probably benign
IGL01586:Sox13 APN 1 133389444 missense possibly damaging 0.70
IGL02750:Sox13 APN 1 133383796 missense probably benign 0.17
IGL02902:Sox13 APN 1 133389466 missense probably damaging 1.00
IGL03388:Sox13 APN 1 133388948 missense probably damaging 0.99
PIT4802001:Sox13 UTSW 1 133386258 missense probably damaging 1.00
R0515:Sox13 UTSW 1 133383719 missense probably damaging 1.00
R1328:Sox13 UTSW 1 133383817 missense probably damaging 0.99
R3766:Sox13 UTSW 1 133390798 missense possibly damaging 0.92
R4591:Sox13 UTSW 1 133383683 missense probably damaging 1.00
R4613:Sox13 UTSW 1 133388934 missense probably benign 0.29
R5715:Sox13 UTSW 1 133386183 critical splice donor site probably null
R5909:Sox13 UTSW 1 133383889 missense probably benign 0.04
R6155:Sox13 UTSW 1 133393267 missense probably damaging 1.00
R7150:Sox13 UTSW 1 133385505 missense possibly damaging 0.89
R7225:Sox13 UTSW 1 133387124 missense probably benign 0.10
R7232:Sox13 UTSW 1 133384391 intron probably null
R7443:Sox13 UTSW 1 133384573 missense probably damaging 1.00
X0021:Sox13 UTSW 1 133385998 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTGCCTCACACAAAG -3'
(R):5'- GCCCTTGATGAGTGCTTATGC -3'

Sequencing Primer
(F):5'- CCTGCTCACGGGATGGTGTAG -3'
(R):5'- CTTGATGAGTGCTTATGCCTTATC -3'
Posted On2019-10-07