Incidental Mutation 'R7443:Abl2'
ID577065
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Namev-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
SynonymsAbll, Arg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156558786-156649568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156625381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 162 (I162T)
Ref Sequence ENSEMBL: ENSMUSP00000027888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172] [ENSMUST00000173929] [ENSMUST00000190749]
Predicted Effect probably damaging
Transcript: ENSMUST00000027888
AA Change: I162T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: I162T

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166172
AA Change: I162T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: I162T

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173929
SMART Domains Protein: ENSMUSP00000133381
Gene: ENSMUSG00000026596

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 89 139 4.35e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190749
AA Change: I155T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140125
Gene: ENSMUSG00000026596
AA Change: I155T

DomainStartEndE-ValueType
SH3 103 159 6.2e-18 SMART
SH2 164 247 8.4e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156635184 missense probably damaging 1.00
IGL01679:Abl2 APN 1 156642465 missense probably benign 0.01
IGL02289:Abl2 APN 1 156629854 missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156633185 missense probably damaging 1.00
R0907:Abl2 UTSW 1 156629859 missense probably damaging 1.00
R1232:Abl2 UTSW 1 156641730 missense probably damaging 1.00
R2069:Abl2 UTSW 1 156620827 splice site probably null
R4224:Abl2 UTSW 1 156633847 missense probably damaging 0.98
R4305:Abl2 UTSW 1 156641563 missense probably damaging 0.99
R4411:Abl2 UTSW 1 156630082 missense possibly damaging 0.86
R4490:Abl2 UTSW 1 156633779 missense probably damaging 1.00
R5132:Abl2 UTSW 1 156641832 nonsense probably null
R5383:Abl2 UTSW 1 156642232 missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156642111 missense probably damaging 1.00
R5436:Abl2 UTSW 1 156629880 missense probably damaging 1.00
R5760:Abl2 UTSW 1 156641857 missense probably benign 0.06
R6051:Abl2 UTSW 1 156642085 missense probably damaging 1.00
R6955:Abl2 UTSW 1 156622649 missense probably damaging 1.00
R7002:Abl2 UTSW 1 156559133 missense probably damaging 1.00
R7038:Abl2 UTSW 1 156641409 missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156622587 missense probably damaging 1.00
R7268:Abl2 UTSW 1 156633939 critical splice donor site probably null
R7282:Abl2 UTSW 1 156630060 missense probably damaging 1.00
R7303:Abl2 UTSW 1 156641250 missense probably benign 0.00
R7372:Abl2 UTSW 1 156622619 missense probably damaging 1.00
R7375:Abl2 UTSW 1 156622614 missense probably damaging 1.00
R7468:Abl2 UTSW 1 156622534 missense possibly damaging 0.68
R7614:Abl2 UTSW 1 156636859 missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156615993 missense probably benign 0.08
R7783:Abl2 UTSW 1 156559071 missense probably benign
R8158:Abl2 UTSW 1 156642069 missense probably benign 0.00
X0067:Abl2 UTSW 1 156631433 splice site probably null
Z1177:Abl2 UTSW 1 156641106 missense probably damaging 1.00
Z1177:Abl2 UTSW 1 156641553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTTGCAGTTTGACACTACACTGC -3'
(R):5'- GAGCCAGTCCACATGAACAG -3'

Sequencing Primer
(F):5'- AGTTTGACACTACACTGCTGCAG -3'
(R):5'- GTCCACATGAACAGGTCTTACC -3'
Posted On2019-10-07