Incidental Mutation 'R7443:Map9'
ID577076
Institutional Source Beutler Lab
Gene Symbol Map9
Ensembl Gene ENSMUSG00000033900
Gene Namemicrotubule-associated protein 9
SynonymsASAP, 5330427D05Rik, Mtap9, 5033421J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location82358044-82395268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82371356 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 221 (E221G)
Ref Sequence ENSEMBL: ENSMUSP00000142014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091014] [ENSMUST00000192595] [ENSMUST00000193559] [ENSMUST00000195471] [ENSMUST00000195640]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091014
AA Change: E221G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088535
Gene: ENSMUSG00000033900
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Pfam:DUF4207 340 566 3.6e-10 PFAM
low complexity region 607 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192595
AA Change: E221G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141828
Gene: ENSMUSG00000033900
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193559
AA Change: E221G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142014
Gene: ENSMUSG00000033900
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 476 513 N/A INTRINSIC
low complexity region 516 537 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195471
AA Change: E221G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141282
Gene: ENSMUSG00000033900
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 476 513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195640
AA Change: E221G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142206
Gene: ENSMUSG00000033900
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Pfam:DUF4207 332 562 4.4e-11 PFAM
low complexity region 564 596 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ASAP is a microtubule-associated protein required for spindle function, mitotic progression, and cytokinesis (Saffin et al., 2005 [PubMed 16049101]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Map9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Map9 APN 3 82363420 missense probably benign 0.37
IGL01520:Map9 APN 3 82378965 missense probably damaging 0.99
IGL02281:Map9 APN 3 82391146 missense possibly damaging 0.53
IGL02931:Map9 APN 3 82377121 missense possibly damaging 0.86
IGL02937:Map9 APN 3 82363512 missense possibly damaging 0.95
IGL02985:Map9 APN 3 82359902 nonsense probably null
IGL03113:Map9 APN 3 82359978 splice site probably benign
R0134:Map9 UTSW 3 82359983 splice site probably benign
R0225:Map9 UTSW 3 82359983 splice site probably benign
R0468:Map9 UTSW 3 82374203 critical splice donor site probably null
R1027:Map9 UTSW 3 82377094 missense probably damaging 1.00
R1794:Map9 UTSW 3 82380221 missense probably damaging 1.00
R4008:Map9 UTSW 3 82359083 missense probably damaging 1.00
R5728:Map9 UTSW 3 82363335 missense probably benign 0.00
R5905:Map9 UTSW 3 82380248 critical splice donor site probably null
R6028:Map9 UTSW 3 82380248 critical splice donor site probably null
R6334:Map9 UTSW 3 82383305 missense probably damaging 1.00
R6798:Map9 UTSW 3 82380164 missense probably damaging 1.00
R7135:Map9 UTSW 3 82363458 missense probably benign 0.03
R7694:Map9 UTSW 3 82358983 start gained probably benign
R8224:Map9 UTSW 3 82359063 missense probably benign 0.33
R8237:Map9 UTSW 3 82377160 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCGGTCTTGATGCAGATG -3'
(R):5'- GCGTGTAAAACCATGCTACCTAC -3'

Sequencing Primer
(F):5'- TGCAGATGGCCACTTTAAGC -3'
(R):5'- GCTACCTACATCTTCAGTTAAGGG -3'
Posted On2019-10-07