Incidental Mutation 'R7443:Hemgn'
ID577077
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46396145 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 364 (F364I)
Ref Sequence ENSEMBL: ENSMUSP00000066383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect probably damaging
Transcript: ENSMUST00000071096
AA Change: F364I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: F364I

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107764
AA Change: F364I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: F364I

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
PIT4504001:Hemgn UTSW 4 46395863 missense probably benign
R0925:Hemgn UTSW 4 46397049 missense probably damaging 0.98
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46396421 missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R5456:Hemgn UTSW 4 46396571 missense probably damaging 0.99
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6575:Hemgn UTSW 4 46395990 missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCAGGCCCCGACATTTCATG -3'
(R):5'- GTAACACCTGGAGATGCTGCTG -3'

Sequencing Primer
(F):5'- CGACATTTCATGGCAGGTTTCCAG -3'
(R):5'- CCCAATCAGATGTCGCTGAAGG -3'
Posted On2019-10-07