Incidental Mutation 'R7443:Rsbn1l'
ID577080
Institutional Source Beutler Lab
Gene Symbol Rsbn1l
Ensembl Gene ENSMUSG00000039968
Gene Nameround spermatid basic protein 1-like
SynonymsC330002G24Rik, 8430412F05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7443 (G1)
Quality Score184.009
Status Not validated
Chromosome5
Chromosomal Location20893028-20956398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20927623 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 213 (K213E)
Ref Sequence ENSEMBL: ENSMUSP00000142789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036489] [ENSMUST00000196780] [ENSMUST00000197089]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036489
AA Change: K213E

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039482
Gene: ENSMUSG00000039968
AA Change: K213E

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196780
AA Change: K213E

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142789
Gene: ENSMUSG00000039968
AA Change: K213E

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197089
AA Change: K64E
SMART Domains Protein: ENSMUSP00000142461
Gene: ENSMUSG00000039968
AA Change: K64E

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Rsbn1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Rsbn1l APN 5 20896155 missense probably benign 0.08
IGL01631:Rsbn1l APN 5 20896571 missense probably damaging 1.00
IGL01631:Rsbn1l APN 5 20896572 missense probably damaging 1.00
IGL02237:Rsbn1l APN 5 20919606 missense probably benign 0.39
IGL02434:Rsbn1l APN 5 20919734 missense probably damaging 0.99
IGL02458:Rsbn1l APN 5 20951736 missense probably damaging 0.99
IGL02994:Rsbn1l APN 5 20908234 missense probably damaging 1.00
PIT4280001:Rsbn1l UTSW 5 20919655 missense probably damaging 1.00
R0288:Rsbn1l UTSW 5 20920040 missense probably damaging 0.97
R1429:Rsbn1l UTSW 5 20920018 missense probably damaging 1.00
R1524:Rsbn1l UTSW 5 20951673 missense probably damaging 1.00
R1713:Rsbn1l UTSW 5 20951490 missense probably benign 0.18
R1875:Rsbn1l UTSW 5 20951698 missense probably benign 0.17
R1998:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R1999:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2000:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2504:Rsbn1l UTSW 5 20902366 missense probably damaging 1.00
R2566:Rsbn1l UTSW 5 20919769 missense probably benign 0.40
R3434:Rsbn1l UTSW 5 20905930 splice site probably benign
R3789:Rsbn1l UTSW 5 20896108 missense probably benign 0.24
R3893:Rsbn1l UTSW 5 20905840 missense probably damaging 1.00
R3924:Rsbn1l UTSW 5 20919787 missense probably damaging 1.00
R4335:Rsbn1l UTSW 5 20908193 missense probably null 0.45
R4422:Rsbn1l UTSW 5 20896546 missense probably damaging 1.00
R5131:Rsbn1l UTSW 5 20896245 missense possibly damaging 0.89
R5212:Rsbn1l UTSW 5 20896214 missense probably benign 0.03
R5739:Rsbn1l UTSW 5 20905816 missense probably damaging 1.00
R6736:Rsbn1l UTSW 5 20908224 missense probably benign 0.45
R6980:Rsbn1l UTSW 5 20896484 missense probably benign
R7252:Rsbn1l UTSW 5 20908198 missense probably damaging 1.00
R7538:Rsbn1l UTSW 5 20896457 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTCCCACGCAGATTACAAT -3'
(R):5'- AAGAAGAAATGTAGAAGTTTTCAGGT -3'

Sequencing Primer
(F):5'- GATTACAATTCCCAACCCCTGG -3'
(R):5'- CATCAGGCTCAACATGCTTATG -3'
Posted On2019-10-07