Incidental Mutation 'R7443:Rps5'
ID577088
Institutional Source Beutler Lab
Gene Symbol Rps5
Ensembl Gene ENSMUSG00000012848
Gene Nameribosomal protein S5
SynonymsS5 ribosomal protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12922290-12926686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12922995 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000004554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004554] [ENSMUST00000045870] [ENSMUST00000108539] [ENSMUST00000137329] [ENSMUST00000147435]
Predicted Effect probably benign
Transcript: ENSMUST00000004554
AA Change: T8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004554
Gene: ENSMUSG00000012848
AA Change: T8A

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 204 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045870
SMART Domains Protein: ENSMUSP00000042816
Gene: ENSMUSG00000033967

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
RING 63 110 2.91e-6 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 175 196 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108539
AA Change: T8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104179
Gene: ENSMUSG00000012848
AA Change: T8A

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 51 204 1.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137329
AA Change: T8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121961
Gene: ENSMUSG00000012848
AA Change: T8A

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 182 1.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147435
AA Change: T8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118798
Gene: ENSMUSG00000012848
AA Change: T8A

DomainStartEndE-ValueType
Pfam:Ribosomal_S7 49 182 1.2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Rps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0585:Rps5 UTSW 7 12925405 missense possibly damaging 0.93
R2474:Rps5 UTSW 7 12926561 splice site probably null
R5750:Rps5 UTSW 7 12925407 missense probably damaging 1.00
R5861:Rps5 UTSW 7 12925574 missense probably damaging 0.96
R6905:Rps5 UTSW 7 12925858 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGGTCCATGTACCAGCTG -3'
(R):5'- GCCCTTTTCTGAACTAGAAGCTC -3'

Sequencing Primer
(F):5'- CTGCCGAGTTACTTTAGAATCCTGAG -3'
(R):5'- TTTCTGAACTAGAAGCTCATCCAC -3'
Posted On2019-10-07