Incidental Mutation 'R7443:Otoa'
ID577094
Institutional Source Beutler Lab
Gene Symbol Otoa
Ensembl Gene ENSMUSG00000034990
Gene Nameotoancorin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location121081650-121163097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121132410 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 618 (M618L)
Ref Sequence ENSEMBL: ENSMUSP00000044177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]
Predicted Effect probably benign
Transcript: ENSMUST00000047025
AA Change: M618L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: M618L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1072 1089 N/A INTRINSIC
low complexity region 1124 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163275
Predicted Effect probably benign
Transcript: ENSMUST00000165409
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Otoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Otoa APN 7 121155273 critical splice donor site probably null
IGL01791:Otoa APN 7 121155849 missense probably benign 0.25
IGL01924:Otoa APN 7 121105968 missense probably damaging 0.99
IGL01953:Otoa APN 7 121160325 splice site probably null
IGL02121:Otoa APN 7 121122024 missense probably benign 0.06
IGL02303:Otoa APN 7 121132924 critical splice donor site probably null
IGL02390:Otoa APN 7 121131367 missense possibly damaging 0.84
IGL02591:Otoa APN 7 121155830 missense probably damaging 1.00
IGL02811:Otoa APN 7 121118655 missense possibly damaging 0.60
IGL02878:Otoa APN 7 121143853 missense probably damaging 1.00
IGL03328:Otoa APN 7 121110994 missense probably damaging 0.98
R0056:Otoa UTSW 7 121131347 missense probably benign 0.00
R0279:Otoa UTSW 7 121111079 splice site probably benign
R0390:Otoa UTSW 7 121131341 missense probably benign 0.07
R0411:Otoa UTSW 7 121156527 critical splice donor site probably null
R0628:Otoa UTSW 7 121145650 splice site probably benign
R1113:Otoa UTSW 7 121125443 nonsense probably null
R1240:Otoa UTSW 7 121156490 missense probably benign
R1308:Otoa UTSW 7 121125443 nonsense probably null
R1692:Otoa UTSW 7 121091551 missense probably damaging 0.99
R1728:Otoa UTSW 7 121125439 missense probably benign 0.36
R1729:Otoa UTSW 7 121125439 missense probably benign 0.36
R1744:Otoa UTSW 7 121127776 splice site probably benign
R1759:Otoa UTSW 7 121134103 missense probably damaging 1.00
R1784:Otoa UTSW 7 121125439 missense probably benign 0.36
R1817:Otoa UTSW 7 121160530 utr 3 prime probably benign
R1961:Otoa UTSW 7 121118569 missense probably benign 0.05
R2061:Otoa UTSW 7 121131328 missense probably damaging 1.00
R2509:Otoa UTSW 7 121160472 missense probably benign
R2510:Otoa UTSW 7 121160472 missense probably benign
R3411:Otoa UTSW 7 121122043 missense probably damaging 1.00
R3438:Otoa UTSW 7 121160343 missense possibly damaging 0.80
R3905:Otoa UTSW 7 121125565 missense probably damaging 1.00
R3907:Otoa UTSW 7 121125565 missense probably damaging 1.00
R4613:Otoa UTSW 7 121145568 missense probably damaging 1.00
R4751:Otoa UTSW 7 121132924 critical splice donor site probably benign
R4896:Otoa UTSW 7 121102679 missense probably damaging 1.00
R4932:Otoa UTSW 7 121155135 missense probably damaging 0.98
R5224:Otoa UTSW 7 121139793 missense probably damaging 0.98
R5235:Otoa UTSW 7 121156470 missense probably damaging 1.00
R5595:Otoa UTSW 7 121121977 missense probably damaging 1.00
R5891:Otoa UTSW 7 121132360 splice site probably null
R5894:Otoa UTSW 7 121121869 missense probably damaging 1.00
R5905:Otoa UTSW 7 121094601 missense probably damaging 1.00
R5976:Otoa UTSW 7 121127713 missense probably benign 0.00
R6464:Otoa UTSW 7 121102605 missense probably damaging 1.00
R6761:Otoa UTSW 7 121121950 missense probably damaging 1.00
R6770:Otoa UTSW 7 121145614 missense probably benign 0.25
R6821:Otoa UTSW 7 121092847 critical splice donor site probably null
R6924:Otoa UTSW 7 121131501 intron probably null
R7016:Otoa UTSW 7 121147766 missense probably damaging 0.99
R7215:Otoa UTSW 7 121118572 missense unknown
R7313:Otoa UTSW 7 121102542 missense probably benign 0.42
R7340:Otoa UTSW 7 121130065 missense probably benign 0.38
R7559:Otoa UTSW 7 121143926 missense probably damaging 0.99
R7640:Otoa UTSW 7 121145626 missense probably damaging 1.00
R7654:Otoa UTSW 7 121147700 missense probably damaging 1.00
R7659:Otoa UTSW 7 121134044 missense probably benign 0.01
U24488:Otoa UTSW 7 121118540 critical splice acceptor site probably null
X0023:Otoa UTSW 7 121118571 missense probably benign 0.00
Z1177:Otoa UTSW 7 121118655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCTCAGCTAGTGTTCAGAG -3'
(R):5'- GCAAGTCTCCTACCCATGTC -3'

Sequencing Primer
(F):5'- CCTCAGCTAGTGTTCAGAGGAGTG -3'
(R):5'- TGAGTCAGAAAGGGACTC -3'
Posted On2019-10-07