Incidental Mutation 'R7443:Plekhg4'
ID577098
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms4931414L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105373274-105382862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105380867 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1010 (L1010P)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably damaging
Transcript: ENSMUST00000014927
AA Change: L974P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: L974P

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160191
AA Change: L905P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: L905P

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Predicted Effect probably damaging
Transcript: ENSMUST00000214056
AA Change: L1010P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 105375738 missense probably benign 0.01
IGL00970:Plekhg4 APN 8 105378435 missense probably benign 0.02
IGL01784:Plekhg4 APN 8 105378957 missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 105379252 splice site probably benign
IGL02371:Plekhg4 APN 8 105379059 unclassified probably null
IGL02984:Plekhg4 UTSW 8 105380388 missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 105375396 nonsense probably null
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 105379302 missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 105381677 nonsense probably null
R1201:Plekhg4 UTSW 8 105381673 missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1418:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1459:Plekhg4 UTSW 8 105381799 missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 105381040 splice site probably benign
R1558:Plekhg4 UTSW 8 105381835 missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 105381781 missense probably benign 0.08
R1757:Plekhg4 UTSW 8 105381661 missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 105378385 missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 105381464 missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2113:Plekhg4 UTSW 8 105379434 missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2196:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2321:Plekhg4 UTSW 8 105377540 missense probably benign 0.00
R2432:Plekhg4 UTSW 8 105381836 missense probably benign 0.00
R2908:Plekhg4 UTSW 8 105380861 missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 105376452 small deletion probably benign
R4179:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 105380402 missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 105380371 nonsense probably null
R4946:Plekhg4 UTSW 8 105381996 missense probably null 0.01
R5223:Plekhg4 UTSW 8 105378949 missense probably benign 0.18
R5362:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 105376113 critical splice donor site probably null
R5609:Plekhg4 UTSW 8 105379502 critical splice donor site probably null
R5624:Plekhg4 UTSW 8 105380750 missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 105378910 missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 105377840 missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 105378697 missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 105378684 missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 105375399 missense probably benign
R7632:Plekhg4 UTSW 8 105380150 missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 105377767 missense probably benign 0.14
Z1177:Plekhg4 UTSW 8 105374842 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGATGAGTTCACAGTGC -3'
(R):5'- GGACTCACCCTTGTTATGGAC -3'

Sequencing Primer
(F):5'- ACAAAGCCTGTCGTCGC -3'
(R):5'- ACCCTTGTTATGGACAGCCTG -3'
Posted On2019-10-07