Incidental Mutation 'R7443:Plxnb1'
ID577101
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109114607 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1921 (F1921L)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: F1921L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: F1921L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 109100175 missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7428:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7527:Plxnb1 UTSW 9 109100861 missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 109100503 nonsense probably null
R7866:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 109109232 missense probably damaging 1.00
R7949:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7981:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
R7988:Plxnb1 UTSW 9 109109232 missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 109100505 missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 109112078 missense probably damaging 0.98
Z1177:Plxnb1 UTSW 9 109108921 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGACACGCCTGCTATCCATG -3'
(R):5'- CCAGTAACTGTGCTGTGGAG -3'

Sequencing Primer
(F):5'- ACGCCTGCTATCCATGAAGGTG -3'
(R):5'- TGCTGTGGAGGCAGAGGC -3'
Posted On2019-10-07