Incidental Mutation 'R7443:Vezf1'
ID577110
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88074663 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 244 (P244T)
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521] [ENSMUST00000143052]
Predicted Effect probably damaging
Transcript: ENSMUST00000018521
AA Change: P244T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377
AA Change: P244T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143052
AA Change: P56T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114394
Gene: ENSMUSG00000018377
AA Change: P56T

DomainStartEndE-ValueType
ZnF_C2H2 14 36 2.99e-4 SMART
ZnF_C2H2 44 67 1.1e-2 SMART
ZnF_C2H2 73 101 2.47e1 SMART
ZnF_C2H2 105 126 2.61e1 SMART
low complexity region 153 169 N/A INTRINSIC
low complexity region 186 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Foxn3 T C 12: 99,388,779 D42G possibly damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0592:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0725:Vezf1 UTSW 11 88073330 missense probably benign 0.04
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0853:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0854:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6452:Vezf1 UTSW 11 88081670 missense possibly damaging 0.66
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Z1176:Vezf1 UTSW 11 88074722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTGGTAGTTATTCCTCG -3'
(R):5'- ACTCCAATCAGTGACTTGAAGAC -3'

Sequencing Primer
(F):5'- ACAGTGGTAGTTATTCCTCGTATTAG -3'
(R):5'- CCAATCAGTGACTTGAAGACTATTC -3'
Posted On2019-10-07