Incidental Mutation 'R7443:Foxn3'
ID577112
Institutional Source Beutler Lab
Gene Symbol Foxn3
Ensembl Gene ENSMUSG00000033713
Gene Nameforkhead box N3
SynonymsHTLFL1, Ches1l, Ches1, 5430426H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R7443 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location99190078-99563582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99388779 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 42 (D42G)
Ref Sequence ENSEMBL: ENSMUSP00000036035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046859] [ENSMUST00000085108] [ENSMUST00000176928] [ENSMUST00000177269] [ENSMUST00000177451] [ENSMUST00000223484]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046859
AA Change: D42G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036035
Gene: ENSMUSG00000033713
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085108
AA Change: D42G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082189
Gene: ENSMUSG00000033713
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000135749
Gene: ENSMUSG00000033713
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:Fork_head 114 155 1.3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177269
AA Change: D42G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135814
Gene: ENSMUSG00000033713
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 191 8.41e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177451
AA Change: D42G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135082
Gene: ENSMUSG00000033713
AA Change: D42G

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223484
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hypomorphic homozygous knockout affects the expression of osteogenic genes and leads to craniofacial abnormalities and reduces pre- and postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik G A 4: 116,173,467 G23R probably benign Het
Abl2 T C 1: 156,625,381 I162T probably damaging Het
Acaca G A 11: 84,315,793 S1493N probably benign Het
Arf2 T A 11: 103,969,150 M18K probably benign Het
Bag5 A G 12: 111,710,727 S221P probably damaging Het
Bcr T C 10: 75,143,136 probably null Het
Btg2 T A 1: 134,077,695 K51* probably null Het
C530008M17Rik T C 5: 76,856,638 V282A unknown Het
Chrne A G 11: 70,618,266 V130A probably benign Het
Cubn T A 2: 13,455,509 D714V probably damaging Het
Cyp4a29 A T 4: 115,248,559 I153F probably damaging Het
D730001G18Rik T C 15: 74,775,400 E32G Het
Dph7 C A 2: 24,962,493 H5Q probably benign Het
Epha6 T C 16: 59,775,625 N901S possibly damaging Het
Exosc9 C A 3: 36,553,841 P66Q probably damaging Het
Gbp11 A G 5: 105,330,950 probably null Het
Gm3264 A T 14: 4,871,265 Y37F probably damaging Het
Gm4951 A T 18: 60,246,050 N219I probably benign Het
H2-M10.2 T A 17: 36,286,053 I44F probably benign Het
Hemgn A T 4: 46,396,145 F364I probably damaging Het
Hnf4a A G 2: 163,559,012 I184V probably benign Het
Ighe G T 12: 113,272,165 C180* probably null Het
Klk1b22 T A 7: 44,116,110 I162K probably benign Het
Lmo3 C T 6: 138,377,222 A104T probably damaging Het
Lsm14a A G 7: 34,353,838 V263A probably benign Het
Ltbp1 T C 17: 75,364,437 Y1538H probably damaging Het
Map9 A G 3: 82,371,356 E221G possibly damaging Het
Mccc2 G A 13: 99,993,636 A71V possibly damaging Het
Mdc1 T A 17: 35,850,820 V875E probably damaging Het
Mier2 A T 10: 79,540,455 I212N unknown Het
Mitd1 T C 1: 37,881,036 T164A probably benign Het
Myh1 T C 11: 67,220,505 I1590T probably benign Het
Mylk2 T G 2: 152,911,426 probably benign Het
Ncapg T A 5: 45,672,310 V118E probably benign Het
Nynrin G A 14: 55,871,416 V1327I probably benign Het
Oas1c C A 5: 120,805,419 K218N probably damaging Het
Olfr1253 T A 2: 89,751,941 M296L probably benign Het
Olfr154 T A 2: 85,663,568 I289F probably damaging Het
Olfr183 T A 16: 58,999,990 F102I probably damaging Het
Olfr382 A T 11: 73,516,848 V117D possibly damaging Het
Olfr46 A G 7: 140,611,048 N286S probably damaging Het
Olfr739 A G 14: 50,425,050 D177G probably damaging Het
Otoa A T 7: 121,132,410 M618L probably benign Het
Plcg2 A T 8: 117,504,289 T37S probably benign Het
Plekhg4 T C 8: 105,380,867 L1010P probably damaging Het
Plxnb1 T C 9: 109,114,607 F1921L probably damaging Het
Prss47 T A 13: 65,049,489 K144N probably damaging Het
Rapgef2 T C 3: 79,081,224 K953E probably damaging Het
Rasip1 T A 7: 45,638,724 I909N probably damaging Het
Rps5 A G 7: 12,922,995 T8A probably benign Het
Rsbn1l T C 5: 20,927,623 K213E possibly damaging Het
Serpinb5 T C 1: 106,881,970 F369L probably benign Het
Slc4a5 T C 6: 83,264,315 V306A probably benign Het
Sox13 C A 1: 133,384,573 K484N probably damaging Het
Sox13 T C 1: 133,384,631 Y465C probably damaging Het
Stx3 A G 19: 11,791,844 I39T possibly damaging Het
Tbc1d5 T C 17: 50,966,735 Y116C probably damaging Het
Tcp11l1 T A 2: 104,684,135 Q429L probably benign Het
Tns3 G A 11: 8,451,442 T952I probably benign Het
Trib3 T C 2: 152,339,772 H176R possibly damaging Het
Trim12a A G 7: 104,300,842 Y297H probably damaging Het
Unc13a A G 8: 71,630,959 V1577A probably damaging Het
Vezf1 C A 11: 88,074,663 P244T probably damaging Het
Vmn1r121 T A 7: 21,098,020 D165V probably damaging Het
Vmn2r117 T A 17: 23,460,133 I706F probably benign Het
Vmn2r117 C T 17: 23,460,345 C635Y probably damaging Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r87 A T 10: 130,472,719 M550K probably damaging Het
Wdr6 A G 9: 108,574,290 L798P probably damaging Het
Wtap C T 17: 12,980,934 G54D probably benign Het
Zfp827 A G 8: 79,190,418 S541G Het
Zkscan3 A T 13: 21,388,438 Y341* probably null Het
Other mutations in Foxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Foxn3 APN 12 99196607 missense possibly damaging 0.90
R0521:Foxn3 UTSW 12 99209506 missense probably benign 0.00
R2248:Foxn3 UTSW 12 99196556 missense probably benign 0.08
R4094:Foxn3 UTSW 12 99196441 missense probably damaging 1.00
R4095:Foxn3 UTSW 12 99196441 missense probably damaging 1.00
R5276:Foxn3 UTSW 12 99196428 nonsense probably null
R6207:Foxn3 UTSW 12 99196310 missense probably damaging 1.00
R6270:Foxn3 UTSW 12 99388417 missense probably damaging 1.00
R6364:Foxn3 UTSW 12 99388693 missense probably benign 0.42
R6379:Foxn3 UTSW 12 99196278 missense probably benign
R7741:Foxn3 UTSW 12 99196328 missense probably damaging 1.00
R8021:Foxn3 UTSW 12 99388902 start codon destroyed probably null 0.99
Z1177:Foxn3 UTSW 12 99388597 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCATAGGGCATGTCCGAGTGG -3'
(R):5'- GGCGGAAACTGATCTGATTCC -3'

Sequencing Primer
(F):5'- CCGAGTGGGCAGGGGATG -3'
(R):5'- GGAAACTGATCTGATTCCTCTTCTGG -3'
Posted On2019-10-07