Incidental Mutation 'R7444:Cntnap5a'
ID577136
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7444 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116292349 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 630 (M630L)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably benign
Transcript: ENSMUST00000043725
AA Change: M630L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: M630L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Ahnak2 T A 12: 112,781,208 Q1673L Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cpb2 A G 14: 75,283,342 Y399C probably damaging Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Hectd3 T A 4: 116,996,927 V258E possibly damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Pnpla1 T C 17: 28,878,481 I207T possibly damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Sh3rf2 G A 18: 42,101,539 R129Q probably damaging Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense probably damaging 1.00
R7290:Cntnap5a UTSW 1 116221889 missense probably damaging 1.00
R7342:Cntnap5a UTSW 1 116060122 missense probably benign 0.00
R7367:Cntnap5a UTSW 1 116442295 missense probably benign 0.00
R7373:Cntnap5a UTSW 1 116580637 missense probably benign 0.20
R7426:Cntnap5a UTSW 1 116442380 missense probably benign 0.03
R7582:Cntnap5a UTSW 1 116446632 missense probably damaging 1.00
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGTTATTAACCAGAGGTAGAACAC -3'
(R):5'- CCTGGTGTGTTAAGCAGACG -3'

Sequencing Primer
(F):5'- ACCAGAGGTAGAACACTATAAGTAAC -3'
(R):5'- TGTTAAGCAGACGGGATCTCCTAC -3'
Posted On2019-10-07