Incidental Mutation 'R7444:Ahnak2'
ID577185
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7444 (G1)
Quality Score168.009
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112781208 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1673 (Q1673L)
Ref Sequence ENSEMBL: ENSMUSP00000114522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526] [ENSMUST00000128258]
Predicted Effect
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: Q1673L

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cntnap5a A T 1: 116,292,349 M630L probably benign Het
Cpb2 A G 14: 75,283,342 Y399C probably damaging Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Hectd3 T A 4: 116,996,927 V258E possibly damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Pnpla1 T C 17: 28,878,481 I207T possibly damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Sh3rf2 G A 18: 42,101,539 R129Q probably damaging Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
R7508:Ahnak2 UTSW 12 112774405 missense possibly damaging 0.46
R7560:Ahnak2 UTSW 12 112779674 missense
R7611:Ahnak2 UTSW 12 112788129 missense
Predicted Primers PCR Primer
(F):5'- CTCAGGTCAGGGGTCTTCAG -3'
(R):5'- TCAAGATGCCCTCCTTCGG -3'

Sequencing Primer
(F):5'- TCAGGGGTCTTCAGGTCGC -3'
(R):5'- TGAAGACCCCTGACCTGAG -3'
Posted On2019-10-07