Incidental Mutation 'R7444:Cpb2'
ID577191
Institutional Source Beutler Lab
Gene Symbol Cpb2
Ensembl Gene ENSMUSG00000021999
Gene Namecarboxypeptidase B2 (plasma)
Synonymscarboxypeptidase U, TAFI, carboxypeptidase R, CPR, CPU, 1110032P04Rik, thrombin-activatable fibrinolysis inhibitor, 4930405E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7444 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location75242287-75283555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75283342 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 399 (Y399C)
Ref Sequence ENSEMBL: ENSMUSP00000022576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022576] [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect probably damaging
Transcript: ENSMUST00000022576
AA Change: Y399C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022576
Gene: ENSMUSG00000021999
AA Change: Y399C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Propep_M14 28 104 2.3e-17 PFAM
Zn_pept 122 406 2.1e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022577
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227049
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase B, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme, and secreted into plasma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice exhibit altered plasma clot lysis and may show reduced bleomycin-induced lung fibrosis, impaired healing of cutaneous wounds and colonic anastomoses, altered glomerular structure, or complement-mediated lethal inflammation after LPS sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Ahnak2 T A 12: 112,781,208 Q1673L Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cntnap5a A T 1: 116,292,349 M630L probably benign Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Hectd3 T A 4: 116,996,927 V258E possibly damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Pnpla1 T C 17: 28,878,481 I207T possibly damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Sh3rf2 G A 18: 42,101,539 R129Q probably damaging Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Cpb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Cpb2 APN 14 75275093 missense possibly damaging 0.64
IGL00925:Cpb2 APN 14 75260750 missense possibly damaging 0.56
IGL01069:Cpb2 APN 14 75270775 missense probably damaging 1.00
IGL01521:Cpb2 APN 14 75257631 missense probably damaging 1.00
IGL02331:Cpb2 APN 14 75283404 missense possibly damaging 0.93
IGL02947:Cpb2 APN 14 75283318 missense probably damaging 1.00
IGL02961:Cpb2 APN 14 75265383 missense probably benign
PIT4677001:Cpb2 UTSW 14 75256023 missense probably benign
R0271:Cpb2 UTSW 14 75257709 splice site probably null
R0277:Cpb2 UTSW 14 75265458 missense probably damaging 1.00
R0372:Cpb2 UTSW 14 75242377 missense probably benign 0.01
R1893:Cpb2 UTSW 14 75255963 missense probably benign 0.44
R1926:Cpb2 UTSW 14 75242397 missense probably benign 0.07
R2372:Cpb2 UTSW 14 75268050 missense probably damaging 0.97
R2923:Cpb2 UTSW 14 75256033 critical splice donor site probably null
R3714:Cpb2 UTSW 14 75283217 splice site probably null
R5958:Cpb2 UTSW 14 75283387 missense probably damaging 1.00
R5987:Cpb2 UTSW 14 75260688 missense probably damaging 1.00
R6354:Cpb2 UTSW 14 75257705 critical splice donor site probably null
R6495:Cpb2 UTSW 14 75275079 missense probably damaging 1.00
R6984:Cpb2 UTSW 14 75265458 missense possibly damaging 0.78
R7211:Cpb2 UTSW 14 75274990 missense probably damaging 1.00
R7380:Cpb2 UTSW 14 75256009 missense possibly damaging 0.77
R7625:Cpb2 UTSW 14 75272549 missense possibly damaging 0.89
R7784:Cpb2 UTSW 14 75275040 missense probably damaging 1.00
R8436:Cpb2 UTSW 14 75272575 missense probably damaging 1.00
R8947:Cpb2 UTSW 14 75278187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGGAAGCTATTTTCGTTTC -3'
(R):5'- CACTCTTAAGCTCAAAGTAGTGTGC -3'

Sequencing Primer
(F):5'- GGAAGCTATTTTCGTTTCTACAATG -3'
(R):5'- GCTCAAAGTAGTGTGCTTTTTATTC -3'
Posted On2019-10-07