Incidental Mutation 'R7444:Pnpla1'
ID577193
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7444 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28878481 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000050123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056866
AA Change: I207T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: I207T

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114737
AA Change: I207T

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286
AA Change: I207T

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Ahnak2 T A 12: 112,781,208 Q1673L Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cntnap5a A T 1: 116,292,349 M630L probably benign Het
Cpb2 A G 14: 75,283,342 Y399C probably damaging Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Hectd3 T A 4: 116,996,927 V258E possibly damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Sh3rf2 G A 18: 42,101,539 R129Q probably damaging Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3620:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5042:Pnpla1 UTSW 17 28881047 missense probably benign
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R5886:Pnpla1 UTSW 17 28876863 missense possibly damaging 0.63
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7400:Pnpla1 UTSW 17 28858976 missense probably damaging 1.00
R7507:Pnpla1 UTSW 17 28876817 missense probably damaging 1.00
R7513:Pnpla1 UTSW 17 28858807 start gained probably benign
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCACCATTTATCTTGGGGAC -3'
(R):5'- AAAACCATGGGCCCTCTGAG -3'

Sequencing Primer
(F):5'- GCAAAAGGTGTCTCTTCCATGGC -3'
(R):5'- CTCTGAGGGGAGAGGCAC -3'
Posted On2019-10-07