Mutagenetix > Incidental Mutation

Incidental Mutation 'R7445:Ptgs1'

577205

Institutional Source

Beutler Lab

Gene Symbol

Ptgs1

Ensembl Gene

ENSMUSG00000047250

Gene Name

prostaglandin-endoperoxide synthase 1

Synonyms

Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36230426-36252272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 36245210 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 395 (N395K)

Ref Sequence

ENSEMBL: ENSMUSP00000059977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062069]

AlphaFold

P22437

Predicted Effect

probably benign
Transcript: ENSMUST00000062069
AA Change: N395K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: N395K

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
EGF	37	72	2.48e1	SMART
low complexity region	172	185	N/A	INTRINSIC
low complexity region	200	214	N/A	INTRINSIC
Pfam:An_peroxidase	221	528	1.5e-46	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Ptgs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Ptgs1	APN	2	36237219	missense	probably damaging	1.00
IGL02345:Ptgs1	APN	2	36242971	missense	probably null	0.93
IGL02952:Ptgs1	APN	2	36251241	missense	probably benign	0.00
IGL03306:Ptgs1	APN	2	36237705	missense	probably damaging	1.00
PIT4431001:Ptgs1	UTSW	2	36240680	missense	probably damaging	1.00
R0468:Ptgs1	UTSW	2	36249193	missense	probably damaging	1.00
R0638:Ptgs1	UTSW	2	36240856	splice site	probably benign
R1563:Ptgs1	UTSW	2	36245202	missense	possibly damaging	0.53
R1858:Ptgs1	UTSW	2	36242770	missense	probably benign	0.19
R2012:Ptgs1	UTSW	2	36237656	missense	probably benign
R2080:Ptgs1	UTSW	2	36242847	nonsense	probably null
R2116:Ptgs1	UTSW	2	36237696	nonsense	probably null
R4073:Ptgs1	UTSW	2	36237776	missense	probably damaging	1.00
R4163:Ptgs1	UTSW	2	36251334	missense	possibly damaging	0.87
R4862:Ptgs1	UTSW	2	36237255	missense	probably damaging	1.00
R5062:Ptgs1	UTSW	2	36237282	missense	probably damaging	1.00
R5071:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5072:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5073:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5074:Ptgs1	UTSW	2	36251260	missense	probably damaging	1.00
R5373:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5374:Ptgs1	UTSW	2	36251186	missense	probably damaging	1.00
R5419:Ptgs1	UTSW	2	36237222	missense	probably damaging	1.00
R5428:Ptgs1	UTSW	2	36245268	missense	probably benign	0.00
R5918:Ptgs1	UTSW	2	36251077	missense	probably damaging	1.00
R6134:Ptgs1	UTSW	2	36251178	missense	probably damaging	1.00
R6181:Ptgs1	UTSW	2	36251119	missense	probably damaging	1.00
R6240:Ptgs1	UTSW	2	36237285	missense	probably damaging	1.00
R6979:Ptgs1	UTSW	2	36251299	missense	probably benign
R7020:Ptgs1	UTSW	2	36251029	missense	probably damaging	1.00
R7557:Ptgs1	UTSW	2	36245211	missense	possibly damaging	0.92
R7873:Ptgs1	UTSW	2	36251280	missense	probably damaging	1.00
R8215:Ptgs1	UTSW	2	36251167	missense	probably damaging	1.00
R9244:Ptgs1	UTSW	2	36240712	missense	probably damaging	0.96
R9537:Ptgs1	UTSW	2	36230727	missense	unknown
R9709:Ptgs1	UTSW	2	36251192	missense	probably damaging	1.00
Z1176:Ptgs1	UTSW	2	36240776	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATTGAGCTCTGCTGAC -3'
(R):5'- TGGGGAGTTTGAACCAAGTC -3'

Sequencing Primer
(F):5'- ATCTTCCCCTTGTAGGAGAAAC -3'
(R):5'- GAACCAAGTCTGTTGTATCCCAGAG -3'

Posted On

2019-10-07