Incidental Mutation 'R7445:Ptgs1'
ID 577205
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Name prostaglandin-endoperoxide synthase 1
Synonyms Pghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 36230426-36252272 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36245210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 395 (N395K)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
AlphaFold P22437
Predicted Effect probably benign
Transcript: ENSMUST00000062069
AA Change: N395K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: N395K

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36237219 missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36242971 missense probably null 0.93
IGL02952:Ptgs1 APN 2 36251241 missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36237705 missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36240680 missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36249193 missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36240856 splice site probably benign
R1563:Ptgs1 UTSW 2 36245202 missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36242770 missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36237656 missense probably benign
R2080:Ptgs1 UTSW 2 36242847 nonsense probably null
R2116:Ptgs1 UTSW 2 36237696 nonsense probably null
R4073:Ptgs1 UTSW 2 36237776 missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36251334 missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36237255 missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36237282 missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36237222 missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36245268 missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36251077 missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36251178 missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36251119 missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36237285 missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36251299 missense probably benign
R7020:Ptgs1 UTSW 2 36251029 missense probably damaging 1.00
R7557:Ptgs1 UTSW 2 36245211 missense possibly damaging 0.92
R7873:Ptgs1 UTSW 2 36251280 missense probably damaging 1.00
R8215:Ptgs1 UTSW 2 36251167 missense probably damaging 1.00
R9244:Ptgs1 UTSW 2 36240712 missense probably damaging 0.96
Z1176:Ptgs1 UTSW 2 36240776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGAGCTCTGCTGAC -3'
(R):5'- TGGGGAGTTTGAACCAAGTC -3'

Sequencing Primer
(F):5'- ATCTTCCCCTTGTAGGAGAAAC -3'
(R):5'- GAACCAAGTCTGTTGTATCCCAGAG -3'
Posted On 2019-10-07