Incidental Mutation 'R7445:Ccdc28b'
ID577214
Institutional Source Beutler Lab
Gene Symbol Ccdc28b
Ensembl Gene ENSMUSG00000028795
Gene Namecoiled coil domain containing 28B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7445 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129619274-129623947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129622607 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 53 (F53L)
Ref Sequence ENSEMBL: ENSMUSP00000101652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030586] [ENSMUST00000046425] [ENSMUST00000046675] [ENSMUST00000084264] [ENSMUST00000106035] [ENSMUST00000121442] [ENSMUST00000137090] [ENSMUST00000150357] [ENSMUST00000151838] [ENSMUST00000174073]
AlphaFold Q8CEG5
Predicted Effect probably benign
Transcript: ENSMUST00000030586
AA Change: F53L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030586
Gene: ENSMUSG00000028795
AA Change: F53L

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 185 4.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046425
SMART Domains Protein: ENSMUSP00000042153
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 169 478 9.1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046675
SMART Domains Protein: ENSMUSP00000040584
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
low complexity region 150 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084264
SMART Domains Protein: ENSMUSP00000081285
Gene: ENSMUSG00000053841

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:Taxilin 166 478 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106035
AA Change: F53L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101652
Gene: ENSMUSG00000028795
AA Change: F53L

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 86 178 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121442
SMART Domains Protein: ENSMUSP00000113036
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150357
AA Change: F53L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118241
Gene: ENSMUSG00000028795
AA Change: F53L

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 104 7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151838
AA Change: F53L

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122229
Gene: ENSMUSG00000028795
AA Change: F53L

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 120 1.1e-13 PFAM
low complexity region 132 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene localizes to centrosomes and basal bodies. The protein colocalizes with several proteins associated with Bardet-Biedl syndrome (BBS) and participates in the regulation of cilia development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Ccdc28b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4362001:Ccdc28b UTSW 4 129621025 missense probably benign 0.00
R0722:Ccdc28b UTSW 4 129621152 critical splice acceptor site probably null
R1172:Ccdc28b UTSW 4 129620889 intron probably benign
R1440:Ccdc28b UTSW 4 129620615 missense probably benign
R1842:Ccdc28b UTSW 4 129621013 missense probably damaging 1.00
R2475:Ccdc28b UTSW 4 129620652 splice site probably null
R5396:Ccdc28b UTSW 4 129619445 missense probably damaging 0.99
R6523:Ccdc28b UTSW 4 129620987 missense probably damaging 1.00
R7125:Ccdc28b UTSW 4 129621092 missense probably benign 0.20
R8998:Ccdc28b UTSW 4 129622678 missense probably benign 0.00
Z1176:Ccdc28b UTSW 4 129621104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCTATGTACCTGAGGACACG -3'
(R):5'- TCTCAGACGAAAGAGGGTGC -3'

Sequencing Primer
(F):5'- AGGACACGTCGGGTCTACATC -3'
(R):5'- AAGGGATGATTTTGCCCCC -3'
Posted On2019-10-07