Incidental Mutation 'R7445:Camta1'
ID 577215
Institutional Source Beutler Lab
Gene Symbol Camta1
Ensembl Gene ENSMUSG00000014592
Gene Name calmodulin binding transcription activator 1
Synonyms 2310058O09Rik, 1810059M14Rik
MMRRC Submission 045521-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 151143980-151946225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 151228748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 695 (E695K)
Ref Sequence ENSEMBL: ENSMUSP00000054804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049790] [ENSMUST00000097774] [ENSMUST00000169423]
AlphaFold A2A891
Predicted Effect possibly damaging
Transcript: ENSMUST00000049790
AA Change: E695K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054804
Gene: ENSMUSG00000014592
AA Change: E695K

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3e-13 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097774
AA Change: E695K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095381
Gene: ENSMUSG00000014592
AA Change: E695K

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1570 5.45e1 SMART
IQ 1571 1593 5.42e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169423
AA Change: E695K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592
AA Change: E695K

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Global or nervous system deletion of this gene results in decreased body size, severe ataxia, progressive Purkinje cell degeneration, and cerebellar atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,962 (GRCm39) S233T probably damaging Het
1700034E13Rik T A 18: 52,793,553 (GRCm39) C29S probably damaging Het
Acsbg3 G A 17: 57,189,973 (GRCm39) R333Q possibly damaging Het
Ank3 A G 10: 69,827,954 (GRCm39) T2208A Het
Ap4s1 T C 12: 51,785,424 (GRCm39) L132P probably damaging Het
Ascl4 C T 10: 85,764,364 (GRCm39) R4C probably benign Het
Brd7 A T 8: 89,088,336 (GRCm39) Y18N probably damaging Het
Cacna2d3 A G 14: 28,780,575 (GRCm39) S648P possibly damaging Het
Ccdc28b A G 4: 129,516,400 (GRCm39) F53L probably benign Het
Chaf1a A G 17: 56,369,170 (GRCm39) D467G possibly damaging Het
Cnnm1 G A 19: 43,429,260 (GRCm39) R126H possibly damaging Het
Cog5 T G 12: 31,969,671 (GRCm39) S730R possibly damaging Het
Col11a1 A T 3: 113,987,578 (GRCm39) E1374D unknown Het
Csmd1 A G 8: 16,208,268 (GRCm39) I1229T possibly damaging Het
Degs1l A G 1: 180,882,577 (GRCm39) N113S possibly damaging Het
Dnajc30 T C 5: 135,093,232 (GRCm39) L43P probably damaging Het
Eif3f C T 7: 108,533,865 (GRCm39) T76M unknown Het
Ermap G A 4: 119,045,907 (GRCm39) T42I unknown Het
Gpd1l C T 9: 114,749,742 (GRCm39) G25S probably damaging Het
Heatr1 G T 13: 12,445,919 (GRCm39) W1632L possibly damaging Het
Ice1 T C 13: 70,744,286 (GRCm39) D29G Het
Ipo8 T C 6: 148,691,315 (GRCm39) D685G probably benign Het
Klra10 T C 6: 130,252,819 (GRCm39) T152A probably benign Het
Lmntd1 T A 6: 145,375,693 (GRCm39) S82C probably damaging Het
Maip1 T C 1: 57,446,190 (GRCm39) S87P possibly damaging Het
Mapkapk2 A G 1: 131,025,256 (GRCm39) S3P unknown Het
Mei4 A G 9: 81,772,292 (GRCm39) Y35C possibly damaging Het
Ms4a14 T G 19: 11,280,336 (GRCm39) K741Q probably benign Het
Mtcl3 T C 10: 29,072,999 (GRCm39) S764P possibly damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Ncapg2 A G 12: 116,382,888 (GRCm39) I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 (GRCm39) M145K probably damaging Het
Nmur2 A G 11: 55,923,766 (GRCm39) F263L probably damaging Het
Ntrk2 A G 13: 58,994,576 (GRCm39) E164G probably benign Het
Or2ag1 A G 7: 106,472,549 (GRCm39) L301S possibly damaging Het
Or4c58 T A 2: 89,674,616 (GRCm39) T234S probably damaging Het
Or6c5b A T 10: 129,245,754 (GRCm39) D173V probably benign Het
P3h2 T A 16: 25,803,815 (GRCm39) Y317F probably damaging Het
Pcmtd1 C T 1: 7,190,644 (GRCm39) R38C probably damaging Het
Pcyox1 T C 6: 86,368,661 (GRCm39) T286A possibly damaging Het
Pdxk T C 10: 78,283,801 (GRCm39) D131G probably benign Het
Ppl T C 16: 4,906,932 (GRCm39) D1121G probably damaging Het
Prkra T C 2: 76,463,942 (GRCm39) D240G probably benign Het
Ptgs1 C A 2: 36,135,222 (GRCm39) N395K probably benign Het
Ptprq A T 10: 107,426,820 (GRCm39) Y1572N probably damaging Het
Pyroxd1 A T 6: 142,304,227 (GRCm39) H326L probably benign Het
Rapgef5 A G 12: 117,719,704 (GRCm39) D778G probably benign Het
Rbm46 T A 3: 82,771,517 (GRCm39) E366V probably damaging Het
Rnd1 G T 15: 98,568,550 (GRCm39) H209Q probably benign Het
Rnf122 A T 8: 31,608,528 (GRCm39) D32V possibly damaging Het
Samd4b G A 7: 28,105,881 (GRCm39) P446S probably benign Het
Slco1a5 C A 6: 142,204,734 (GRCm39) A187S possibly damaging Het
Smarca4 G A 9: 21,597,543 (GRCm39) V1436M probably damaging Het
Smok2a G A 17: 13,445,526 (GRCm39) G368R possibly damaging Het
Smok3c T A 5: 138,062,757 (GRCm39) H81Q probably damaging Het
Stk16 T C 1: 75,190,296 (GRCm39) V245A probably damaging Het
Svep1 A T 4: 58,094,122 (GRCm39) N1505K possibly damaging Het
Tigd4 G A 3: 84,502,471 (GRCm39) A463T probably benign Het
Tmem117 T C 15: 94,612,799 (GRCm39) F112L probably benign Het
Tmem72 A G 6: 116,675,291 (GRCm39) I67T probably benign Het
Tnik A G 3: 28,718,058 (GRCm39) probably null Het
Trav14-2 A G 14: 53,878,515 (GRCm39) Q66R probably damaging Het
Trpv6 T A 6: 41,598,276 (GRCm39) D677V probably damaging Het
Vgll4 C T 6: 114,839,157 (GRCm39) S278N unknown Het
Wdfy4 C T 14: 32,792,575 (GRCm39) W2157* probably null Het
Other mutations in Camta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Camta1 APN 4 151,155,881 (GRCm39) critical splice donor site probably null
IGL00823:Camta1 APN 4 151,169,058 (GRCm39) missense probably benign 0.02
IGL01361:Camta1 APN 4 151,229,149 (GRCm39) missense probably damaging 1.00
IGL01523:Camta1 APN 4 151,229,507 (GRCm39) missense possibly damaging 0.73
IGL01730:Camta1 APN 4 151,147,302 (GRCm39) missense probably damaging 0.99
IGL02045:Camta1 APN 4 151,158,442 (GRCm39) splice site probably null
IGL02541:Camta1 APN 4 151,169,112 (GRCm39) missense probably benign 0.12
IGL02839:Camta1 APN 4 151,228,969 (GRCm39) missense probably damaging 1.00
IGL03012:Camta1 APN 4 151,537,756 (GRCm39) missense probably damaging 1.00
Bonus UTSW 4 151,222,832 (GRCm39) missense probably damaging 1.00
BB010:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
BB020:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
PIT4449001:Camta1 UTSW 4 151,216,043 (GRCm39) missense probably benign 0.00
R0136:Camta1 UTSW 4 151,163,426 (GRCm39) missense probably damaging 0.99
R0239:Camta1 UTSW 4 151,228,187 (GRCm39) missense probably damaging 1.00
R0239:Camta1 UTSW 4 151,228,187 (GRCm39) missense probably damaging 1.00
R0276:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0346:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0347:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0348:Camta1 UTSW 4 151,670,888 (GRCm39) missense possibly damaging 0.64
R0385:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0386:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0388:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0410:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0456:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0478:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0510:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0511:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0683:Camta1 UTSW 4 151,159,597 (GRCm39) missense probably damaging 1.00
R0724:Camta1 UTSW 4 151,162,349 (GRCm39) missense probably damaging 1.00
R0732:Camta1 UTSW 4 151,670,941 (GRCm39) critical splice acceptor site probably null
R1549:Camta1 UTSW 4 151,670,920 (GRCm39) missense probably damaging 1.00
R1670:Camta1 UTSW 4 151,164,228 (GRCm39) missense probably benign 0.00
R1704:Camta1 UTSW 4 151,159,681 (GRCm39) missense probably damaging 1.00
R1718:Camta1 UTSW 4 151,168,481 (GRCm39) missense probably benign 0.00
R1941:Camta1 UTSW 4 151,159,612 (GRCm39) missense probably damaging 1.00
R1967:Camta1 UTSW 4 151,173,430 (GRCm39) missense probably damaging 0.99
R1998:Camta1 UTSW 4 151,162,337 (GRCm39) missense probably damaging 1.00
R2081:Camta1 UTSW 4 151,228,699 (GRCm39) missense probably benign 0.24
R2104:Camta1 UTSW 4 151,537,751 (GRCm39) missense probably damaging 0.99
R2240:Camta1 UTSW 4 151,169,032 (GRCm39) missense possibly damaging 0.66
R4516:Camta1 UTSW 4 151,229,177 (GRCm39) missense possibly damaging 0.90
R4539:Camta1 UTSW 4 151,169,269 (GRCm39) missense probably benign 0.03
R4552:Camta1 UTSW 4 151,876,959 (GRCm39) missense probably damaging 0.96
R4610:Camta1 UTSW 4 151,169,284 (GRCm39) missense probably damaging 1.00
R4658:Camta1 UTSW 4 151,228,367 (GRCm39) missense probably damaging 1.00
R4725:Camta1 UTSW 4 151,232,953 (GRCm39) missense probably benign 0.11
R4786:Camta1 UTSW 4 151,374,496 (GRCm39) missense probably damaging 1.00
R4812:Camta1 UTSW 4 151,215,999 (GRCm39) missense probably null 0.25
R4840:Camta1 UTSW 4 151,228,864 (GRCm39) missense probably benign 0.23
R5038:Camta1 UTSW 4 151,229,926 (GRCm39) missense probably damaging 1.00
R5112:Camta1 UTSW 4 151,158,511 (GRCm39) missense probably damaging 1.00
R5251:Camta1 UTSW 4 151,248,341 (GRCm39) missense probably damaging 1.00
R5388:Camta1 UTSW 4 151,159,695 (GRCm39) missense probably damaging 1.00
R5487:Camta1 UTSW 4 151,229,211 (GRCm39) missense possibly damaging 0.73
R6343:Camta1 UTSW 4 151,164,306 (GRCm39) missense probably damaging 0.98
R6462:Camta1 UTSW 4 151,170,621 (GRCm39) missense probably damaging 0.98
R6550:Camta1 UTSW 4 151,222,832 (GRCm39) missense probably damaging 1.00
R6990:Camta1 UTSW 4 151,229,501 (GRCm39) missense probably damaging 0.97
R7165:Camta1 UTSW 4 151,169,157 (GRCm39) missense possibly damaging 0.63
R7190:Camta1 UTSW 4 151,232,980 (GRCm39) missense possibly damaging 0.57
R7215:Camta1 UTSW 4 151,229,194 (GRCm39) missense probably damaging 1.00
R7264:Camta1 UTSW 4 151,537,856 (GRCm39) missense probably damaging 1.00
R7403:Camta1 UTSW 4 151,537,752 (GRCm39) nonsense probably null
R7447:Camta1 UTSW 4 151,168,327 (GRCm39) missense probably benign 0.31
R7585:Camta1 UTSW 4 151,229,287 (GRCm39) missense probably damaging 1.00
R7751:Camta1 UTSW 4 151,232,863 (GRCm39) splice site probably null
R7881:Camta1 UTSW 4 151,920,333 (GRCm39) missense probably damaging 0.99
R7933:Camta1 UTSW 4 151,168,214 (GRCm39) missense probably damaging 0.99
R7960:Camta1 UTSW 4 151,232,990 (GRCm39) missense probably benign 0.01
R8057:Camta1 UTSW 4 151,228,489 (GRCm39) missense probably damaging 1.00
R8073:Camta1 UTSW 4 151,163,281 (GRCm39) missense probably damaging 1.00
R8241:Camta1 UTSW 4 151,168,282 (GRCm39) missense probably benign 0.00
R8247:Camta1 UTSW 4 151,159,721 (GRCm39) missense probably damaging 1.00
R8466:Camta1 UTSW 4 151,170,577 (GRCm39) nonsense probably null
R9035:Camta1 UTSW 4 151,229,159 (GRCm39) missense probably benign 0.03
R9332:Camta1 UTSW 4 151,228,474 (GRCm39) missense possibly damaging 0.95
R9358:Camta1 UTSW 4 151,222,881 (GRCm39) missense probably damaging 1.00
R9626:Camta1 UTSW 4 151,168,287 (GRCm39) missense probably damaging 0.99
R9649:Camta1 UTSW 4 151,216,004 (GRCm39) missense possibly damaging 0.82
X0063:Camta1 UTSW 4 151,229,704 (GRCm39) missense probably damaging 1.00
Z1176:Camta1 UTSW 4 151,228,842 (GRCm39) missense probably benign 0.06
Z1177:Camta1 UTSW 4 151,162,382 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGAGCTCCATGTTAGAG -3'
(R):5'- TTGAGCAGAATACCCACAGCAG -3'

Sequencing Primer
(F):5'- CCATGTTAGAGCTGTTGCCCAG -3'
(R):5'- CAGCAGCCTAAGCGAGTCAG -3'
Posted On 2019-10-07