Incidental Mutation 'R7445:Trpv6'
ID 577219
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Name transient receptor potential cation channel, subfamily V, member 6
Synonyms Ecac2, CaT1, CAT, Cac
MMRRC Submission 045521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 41597558-41613339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41598276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 677 (D677V)
Ref Sequence ENSEMBL: ENSMUSP00000031902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
AlphaFold Q91WD2
Predicted Effect probably damaging
Transcript: ENSMUST00000031902
AA Change: D677V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: D677V

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: D677V

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.1953 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,962 (GRCm39) S233T probably damaging Het
1700034E13Rik T A 18: 52,793,553 (GRCm39) C29S probably damaging Het
Acsbg3 G A 17: 57,189,973 (GRCm39) R333Q possibly damaging Het
Ank3 A G 10: 69,827,954 (GRCm39) T2208A Het
Ap4s1 T C 12: 51,785,424 (GRCm39) L132P probably damaging Het
Ascl4 C T 10: 85,764,364 (GRCm39) R4C probably benign Het
Brd7 A T 8: 89,088,336 (GRCm39) Y18N probably damaging Het
Cacna2d3 A G 14: 28,780,575 (GRCm39) S648P possibly damaging Het
Camta1 C T 4: 151,228,748 (GRCm39) E695K possibly damaging Het
Ccdc28b A G 4: 129,516,400 (GRCm39) F53L probably benign Het
Chaf1a A G 17: 56,369,170 (GRCm39) D467G possibly damaging Het
Cnnm1 G A 19: 43,429,260 (GRCm39) R126H possibly damaging Het
Cog5 T G 12: 31,969,671 (GRCm39) S730R possibly damaging Het
Col11a1 A T 3: 113,987,578 (GRCm39) E1374D unknown Het
Csmd1 A G 8: 16,208,268 (GRCm39) I1229T possibly damaging Het
Degs1l A G 1: 180,882,577 (GRCm39) N113S possibly damaging Het
Dnajc30 T C 5: 135,093,232 (GRCm39) L43P probably damaging Het
Eif3f C T 7: 108,533,865 (GRCm39) T76M unknown Het
Ermap G A 4: 119,045,907 (GRCm39) T42I unknown Het
Gpd1l C T 9: 114,749,742 (GRCm39) G25S probably damaging Het
Heatr1 G T 13: 12,445,919 (GRCm39) W1632L possibly damaging Het
Ice1 T C 13: 70,744,286 (GRCm39) D29G Het
Ipo8 T C 6: 148,691,315 (GRCm39) D685G probably benign Het
Klra10 T C 6: 130,252,819 (GRCm39) T152A probably benign Het
Lmntd1 T A 6: 145,375,693 (GRCm39) S82C probably damaging Het
Maip1 T C 1: 57,446,190 (GRCm39) S87P possibly damaging Het
Mapkapk2 A G 1: 131,025,256 (GRCm39) S3P unknown Het
Mei4 A G 9: 81,772,292 (GRCm39) Y35C possibly damaging Het
Ms4a14 T G 19: 11,280,336 (GRCm39) K741Q probably benign Het
Mtcl3 T C 10: 29,072,999 (GRCm39) S764P possibly damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Ncapg2 A G 12: 116,382,888 (GRCm39) I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 (GRCm39) M145K probably damaging Het
Nmur2 A G 11: 55,923,766 (GRCm39) F263L probably damaging Het
Ntrk2 A G 13: 58,994,576 (GRCm39) E164G probably benign Het
Or2ag1 A G 7: 106,472,549 (GRCm39) L301S possibly damaging Het
Or4c58 T A 2: 89,674,616 (GRCm39) T234S probably damaging Het
Or6c5b A T 10: 129,245,754 (GRCm39) D173V probably benign Het
P3h2 T A 16: 25,803,815 (GRCm39) Y317F probably damaging Het
Pcmtd1 C T 1: 7,190,644 (GRCm39) R38C probably damaging Het
Pcyox1 T C 6: 86,368,661 (GRCm39) T286A possibly damaging Het
Pdxk T C 10: 78,283,801 (GRCm39) D131G probably benign Het
Ppl T C 16: 4,906,932 (GRCm39) D1121G probably damaging Het
Prkra T C 2: 76,463,942 (GRCm39) D240G probably benign Het
Ptgs1 C A 2: 36,135,222 (GRCm39) N395K probably benign Het
Ptprq A T 10: 107,426,820 (GRCm39) Y1572N probably damaging Het
Pyroxd1 A T 6: 142,304,227 (GRCm39) H326L probably benign Het
Rapgef5 A G 12: 117,719,704 (GRCm39) D778G probably benign Het
Rbm46 T A 3: 82,771,517 (GRCm39) E366V probably damaging Het
Rnd1 G T 15: 98,568,550 (GRCm39) H209Q probably benign Het
Rnf122 A T 8: 31,608,528 (GRCm39) D32V possibly damaging Het
Samd4b G A 7: 28,105,881 (GRCm39) P446S probably benign Het
Slco1a5 C A 6: 142,204,734 (GRCm39) A187S possibly damaging Het
Smarca4 G A 9: 21,597,543 (GRCm39) V1436M probably damaging Het
Smok2a G A 17: 13,445,526 (GRCm39) G368R possibly damaging Het
Smok3c T A 5: 138,062,757 (GRCm39) H81Q probably damaging Het
Stk16 T C 1: 75,190,296 (GRCm39) V245A probably damaging Het
Svep1 A T 4: 58,094,122 (GRCm39) N1505K possibly damaging Het
Tigd4 G A 3: 84,502,471 (GRCm39) A463T probably benign Het
Tmem117 T C 15: 94,612,799 (GRCm39) F112L probably benign Het
Tmem72 A G 6: 116,675,291 (GRCm39) I67T probably benign Het
Tnik A G 3: 28,718,058 (GRCm39) probably null Het
Trav14-2 A G 14: 53,878,515 (GRCm39) Q66R probably damaging Het
Vgll4 C T 6: 114,839,157 (GRCm39) S278N unknown Het
Wdfy4 C T 14: 32,792,575 (GRCm39) W2157* probably null Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41,603,801 (GRCm39) splice site probably benign
IGL02033:Trpv6 APN 6 41,604,551 (GRCm39) splice site probably benign
IGL02439:Trpv6 APN 6 41,602,421 (GRCm39) missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41,602,122 (GRCm39) missense probably benign 0.01
R0973:Trpv6 UTSW 6 41,602,122 (GRCm39) missense probably benign 0.01
R0974:Trpv6 UTSW 6 41,602,122 (GRCm39) missense probably benign 0.01
R1385:Trpv6 UTSW 6 41,598,063 (GRCm39) missense probably benign 0.32
R1696:Trpv6 UTSW 6 41,598,702 (GRCm39) missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41,598,690 (GRCm39) missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41,603,045 (GRCm39) missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41,613,010 (GRCm39) missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41,601,550 (GRCm39) nonsense probably null
R3522:Trpv6 UTSW 6 41,604,339 (GRCm39) missense probably damaging 0.99
R4172:Trpv6 UTSW 6 41,602,432 (GRCm39) missense probably damaging 1.00
R4397:Trpv6 UTSW 6 41,602,172 (GRCm39) missense possibly damaging 0.82
R4568:Trpv6 UTSW 6 41,603,503 (GRCm39) missense probably damaging 1.00
R4571:Trpv6 UTSW 6 41,598,678 (GRCm39) missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41,613,088 (GRCm39) missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41,602,356 (GRCm39) splice site probably null
R6989:Trpv6 UTSW 6 41,602,390 (GRCm39) missense probably damaging 1.00
R7427:Trpv6 UTSW 6 41,602,087 (GRCm39) missense probably benign
R7538:Trpv6 UTSW 6 41,603,101 (GRCm39) missense probably benign 0.01
R7960:Trpv6 UTSW 6 41,604,612 (GRCm39) missense probably benign 0.00
R8059:Trpv6 UTSW 6 41,601,520 (GRCm39) missense probably benign 0.00
R9159:Trpv6 UTSW 6 41,603,074 (GRCm39) missense probably benign
R9307:Trpv6 UTSW 6 41,602,378 (GRCm39) missense probably benign 0.31
R9635:Trpv6 UTSW 6 41,599,901 (GRCm39) missense possibly damaging 0.90
R9732:Trpv6 UTSW 6 41,603,862 (GRCm39) nonsense probably null
R9745:Trpv6 UTSW 6 41,600,003 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAAGCCTTTCCCAATTGG -3'
(R):5'- TCAGTTTTGAGCTTGGGCCC -3'

Sequencing Primer
(F):5'- GAAGCCTTTCCCAATTGGTGCTG -3'
(R):5'- TTGGGCCCCTAAGCATCATCAG -3'
Posted On 2019-10-07