Mutagenetix > Incidental Mutation

Incidental Mutation 'R7445:Slco1a5'

577224

Institutional Source

Beutler Lab

Gene Symbol

Slco1a5

Ensembl Gene

ENSMUSG00000063975

Gene Name

solute carrier organic anion transporter family, member 1a5

Synonyms

Oatp3, Slc21a7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142234227-142322981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 142259008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 187 (A187S)

Ref Sequence

ENSEMBL: ENSMUSP00000080116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000128446] [ENSMUST00000153268]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081380
AA Change: A187S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: A187S

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	4.3e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111825
AA Change: A187S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: A187S

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	5.8e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128446
AA Change: A145S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124987
Gene: ENSMUSG00000063975
AA Change: A145S

Domain	Start	End	E-Value	Type
Pfam:OATP	1	157	6.1e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153268

SMART Domains

Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:OATP	19	74	3.4e-16	PFAM

Meta Mutation Damage Score

0.1589

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Slco1a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Slco1a5	APN	6	142242150	missense	probably benign	0.00
IGL01432:Slco1a5	APN	6	142236286	missense	possibly damaging	0.59
IGL01590:Slco1a5	APN	6	142250319	missense	probably benign	0.01
IGL01824:Slco1a5	APN	6	142253037	missense	probably benign	0.01
IGL01915:Slco1a5	APN	6	142243873	missense	probably benign	0.00
IGL01945:Slco1a5	APN	6	142243989	critical splice acceptor site	probably null
IGL02078:Slco1a5	APN	6	142254446	missense	probably benign	0.30
IGL02178:Slco1a5	APN	6	142262688	nonsense	probably null
IGL02366:Slco1a5	APN	6	142250215	missense	possibly damaging	0.57
IGL02395:Slco1a5	APN	6	142275487	missense	probably damaging	0.99
IGL02621:Slco1a5	APN	6	142242015	missense	probably benign	0.10
IGL02752:Slco1a5	APN	6	142262712	missense	probably benign	0.07
IGL02940:Slco1a5	APN	6	142242005	missense	probably damaging	1.00
IGL03065:Slco1a5	APN	6	142248843	splice site	probably benign
IGL03377:Slco1a5	APN	6	142234766	missense	probably benign	0.01
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0230:Slco1a5	UTSW	6	142236328	splice site	probably benign
R0690:Slco1a5	UTSW	6	142268278	missense	probably benign	0.24
R1217:Slco1a5	UTSW	6	142254374	missense	probably damaging	0.98
R1900:Slco1a5	UTSW	6	142242063	missense	probably benign	0.44
R2084:Slco1a5	UTSW	6	142234711	missense	probably benign	0.32
R2393:Slco1a5	UTSW	6	142248775	missense	possibly damaging	0.85
R2414:Slco1a5	UTSW	6	142236250	missense	probably damaging	1.00
R2760:Slco1a5	UTSW	6	142250271	missense	probably benign	0.00
R3420:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3421:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3827:Slco1a5	UTSW	6	142253249	missense	probably damaging	0.97
R3963:Slco1a5	UTSW	6	142248644	critical splice donor site	probably null
R3977:Slco1a5	UTSW	6	142258972	splice site	probably benign
R4074:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4075:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4076:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4782:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4799:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4831:Slco1a5	UTSW	6	142234705	missense	probably benign
R5038:Slco1a5	UTSW	6	142262637	missense	probably benign	0.01
R5038:Slco1a5	UTSW	6	142266364	missense	probably damaging	1.00
R5063:Slco1a5	UTSW	6	142259065	missense	probably damaging	1.00
R5273:Slco1a5	UTSW	6	142242098	missense	probably benign	0.00
R5436:Slco1a5	UTSW	6	142254392	missense	probably damaging	1.00
R5579:Slco1a5	UTSW	6	142242125	missense	possibly damaging	0.93
R5602:Slco1a5	UTSW	6	142275529	start gained	probably benign
R5643:Slco1a5	UTSW	6	142237594	splice site	probably null
R5644:Slco1a5	UTSW	6	142237594	splice site	probably null
R5686:Slco1a5	UTSW	6	142236307	missense	probably damaging	1.00
R5699:Slco1a5	UTSW	6	142248816	missense	probably damaging	0.96
R5792:Slco1a5	UTSW	6	142242113	missense	probably damaging	1.00
R5938:Slco1a5	UTSW	6	142248717	missense	probably damaging	0.97
R5997:Slco1a5	UTSW	6	142253113	missense	probably benign	0.19
R6146:Slco1a5	UTSW	6	142234808	missense	probably benign
R6377:Slco1a5	UTSW	6	142242180	splice site	probably null
R6466:Slco1a5	UTSW	6	142237534	missense	probably benign	0.01
R6523:Slco1a5	UTSW	6	142266395	missense	probably damaging	1.00
R7092:Slco1a5	UTSW	6	142248675	missense	probably benign
R7207:Slco1a5	UTSW	6	142248749	nonsense	probably null
R7356:Slco1a5	UTSW	6	142234732	missense	probably benign	0.01
R7430:Slco1a5	UTSW	6	142248712	missense	probably benign	0.00
R7499:Slco1a5	UTSW	6	142262531	splice site	probably null
R7579:Slco1a5	UTSW	6	142275481	missense	probably benign	0.00
R8117:Slco1a5	UTSW	6	142262692	missense	probably damaging	1.00
R8209:Slco1a5	UTSW	6	142262682	missense	probably damaging	1.00
R8217:Slco1a5	UTSW	6	142275476	missense	probably benign	0.13
R8358:Slco1a5	UTSW	6	142262685	missense	probably benign	0.45
R8710:Slco1a5	UTSW	6	142253102	missense	probably benign	0.03
R9071:Slco1a5	UTSW	6	142250326	missense	possibly damaging	0.50
R9316:Slco1a5	UTSW	6	142250209	missense	probably damaging	0.99
R9427:Slco1a5	UTSW	6	142268275	missense	probably damaging	0.98
R9619:Slco1a5	UTSW	6	142253120	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GGTCAACCCTCCTTGAACAATC -3'
(R):5'- TGAATGGTCATGGCCTGTAAC -3'

Sequencing Primer
(F):5'- TCTCATGATCTACAGAGGCATAGC -3'
(R):5'- TGGTCATGGCCTGTAACCAGAG -3'

Posted On

2019-10-07