Mutagenetix > Incidental Mutation

Incidental Mutation 'R7445:Ipo8'

577227

Institutional Source

Beutler Lab

Gene Symbol

Ipo8

Ensembl Gene

ENSMUSG00000040029

Gene Name

importin 8

Synonyms

OM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148770683-148831467 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148789817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 685 (D685G)

Ref Sequence

ENSEMBL: ENSMUSP00000046759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048418]

AlphaFold

Q7TMY7

Predicted Effect

probably benign
Transcript: ENSMUST00000048418
AA Change: D685G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029
AA Change: D685G

Domain	Start	End	E-Value	Type
IBN_N	22	102	1.59e-13	SMART
Pfam:Cse1	166	470	6.6e-11	PFAM
low complexity region	895	908	N/A	INTRINSIC
low complexity region	924	938	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Ipo8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ipo8	APN	6	148782786	missense	possibly damaging	0.77
IGL01012:Ipo8	APN	6	148789063	splice site	probably benign
IGL01124:Ipo8	APN	6	148777376	missense	probably benign
IGL01978:Ipo8	APN	6	148777289	missense	probably benign	0.25
IGL02111:Ipo8	APN	6	148799780	missense	probably damaging	1.00
IGL02193:Ipo8	APN	6	148777284	missense	probably damaging	0.96
IGL02589:Ipo8	APN	6	148809907	missense	probably damaging	0.98
IGL02690:Ipo8	APN	6	148777363	missense	probably benign
IGL02724:Ipo8	APN	6	148791481	nonsense	probably null
IGL02935:Ipo8	APN	6	148789841	missense	probably benign	0.03
IGL03027:Ipo8	APN	6	148777239	missense	probably benign	0.01
IGL03065:Ipo8	APN	6	148784707	missense	probably benign	0.44
IGL03338:Ipo8	APN	6	148800257	missense	probably benign	0.01
important	UTSW	6	148816497	nonsense	probably null
R0032:Ipo8	UTSW	6	148810711	missense	probably damaging	0.99
R0032:Ipo8	UTSW	6	148810711	missense	probably damaging	0.99
R0088:Ipo8	UTSW	6	148801936	missense	probably benign	0.27
R0373:Ipo8	UTSW	6	148775042	missense	probably benign	0.00
R0539:Ipo8	UTSW	6	148818108	missense	probably benign	0.00
R0565:Ipo8	UTSW	6	148786723	missense	probably damaging	1.00
R0660:Ipo8	UTSW	6	148800213	missense	probably benign	0.02
R0664:Ipo8	UTSW	6	148800213	missense	probably benign	0.02
R0791:Ipo8	UTSW	6	148821727	missense	possibly damaging	0.94
R0989:Ipo8	UTSW	6	148796682	missense	probably benign	0.38
R1416:Ipo8	UTSW	6	148789093	missense	probably benign
R1417:Ipo8	UTSW	6	148818052	missense	probably benign	0.02
R1590:Ipo8	UTSW	6	148810665	splice site	probably null
R1703:Ipo8	UTSW	6	148789892	missense	probably benign	0.00
R1709:Ipo8	UTSW	6	148782728	missense	probably benign
R2079:Ipo8	UTSW	6	148789162	missense	probably damaging	1.00
R2338:Ipo8	UTSW	6	148789823	missense	probably benign	0.00
R2359:Ipo8	UTSW	6	148816477	splice site	probably benign
R2696:Ipo8	UTSW	6	148796741	missense	probably benign	0.01
R3407:Ipo8	UTSW	6	148821709	missense	probably benign	0.03
R3408:Ipo8	UTSW	6	148821709	missense	probably benign	0.03
R3709:Ipo8	UTSW	6	148806344	splice site	probably null
R3710:Ipo8	UTSW	6	148806344	splice site	probably null
R3945:Ipo8	UTSW	6	148818117	missense	probably damaging	1.00
R4326:Ipo8	UTSW	6	148800164	unclassified	probably benign
R4329:Ipo8	UTSW	6	148800164	unclassified	probably benign
R6105:Ipo8	UTSW	6	148798670	missense	probably damaging	1.00
R6148:Ipo8	UTSW	6	148799780	missense	probably damaging	1.00
R6359:Ipo8	UTSW	6	148777250	missense	probably benign	0.01
R6377:Ipo8	UTSW	6	148816497	nonsense	probably null
R6724:Ipo8	UTSW	6	148809975	splice site	probably null
R7283:Ipo8	UTSW	6	148824481	missense	possibly damaging	0.86
R7436:Ipo8	UTSW	6	148789805	missense	probably benign	0.13
R8044:Ipo8	UTSW	6	148809923	missense	probably damaging	1.00
R8209:Ipo8	UTSW	6	148796678	missense	possibly damaging	0.93
R8812:Ipo8	UTSW	6	148775077	missense	possibly damaging	0.64
R8943:Ipo8	UTSW	6	148775049	missense	probably benign	0.00
R9067:Ipo8	UTSW	6	148777232	missense	probably damaging	1.00
R9129:Ipo8	UTSW	6	148798627	missense	probably benign	0.05
R9297:Ipo8	UTSW	6	148801578	missense	possibly damaging	0.63
R9419:Ipo8	UTSW	6	148784566	missense	probably benign	0.15
Z1177:Ipo8	UTSW	6	148796712	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGACATGTTGCCCACCTC -3'
(R):5'- GAAGCATCTGACACATGGGG -3'

Sequencing Primer
(F):5'- CCTCTGCCTATCAAAGGGCTG -3'
(R):5'- TGTTTGAGTCCTCTGTGTGGTCC -3'

Posted On

2019-10-07