Incidental Mutation 'R7445:Ipo8'
ID 577227
Institutional Source Beutler Lab
Gene Symbol Ipo8
Ensembl Gene ENSMUSG00000040029
Gene Name importin 8
Synonyms OM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148770683-148831467 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148789817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 685 (D685G)
Ref Sequence ENSEMBL: ENSMUSP00000046759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048418]
AlphaFold Q7TMY7
Predicted Effect probably benign
Transcript: ENSMUST00000048418
AA Change: D685G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029
AA Change: D685G

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
Pfam:Cse1 166 470 6.6e-11 PFAM
low complexity region 895 908 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Ipo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ipo8 APN 6 148782786 missense possibly damaging 0.77
IGL01012:Ipo8 APN 6 148789063 splice site probably benign
IGL01124:Ipo8 APN 6 148777376 missense probably benign
IGL01978:Ipo8 APN 6 148777289 missense probably benign 0.25
IGL02111:Ipo8 APN 6 148799780 missense probably damaging 1.00
IGL02193:Ipo8 APN 6 148777284 missense probably damaging 0.96
IGL02589:Ipo8 APN 6 148809907 missense probably damaging 0.98
IGL02690:Ipo8 APN 6 148777363 missense probably benign
IGL02724:Ipo8 APN 6 148791481 nonsense probably null
IGL02935:Ipo8 APN 6 148789841 missense probably benign 0.03
IGL03027:Ipo8 APN 6 148777239 missense probably benign 0.01
IGL03065:Ipo8 APN 6 148784707 missense probably benign 0.44
IGL03338:Ipo8 APN 6 148800257 missense probably benign 0.01
important UTSW 6 148816497 nonsense probably null
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0088:Ipo8 UTSW 6 148801936 missense probably benign 0.27
R0373:Ipo8 UTSW 6 148775042 missense probably benign 0.00
R0539:Ipo8 UTSW 6 148818108 missense probably benign 0.00
R0565:Ipo8 UTSW 6 148786723 missense probably damaging 1.00
R0660:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0664:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0791:Ipo8 UTSW 6 148821727 missense possibly damaging 0.94
R0989:Ipo8 UTSW 6 148796682 missense probably benign 0.38
R1416:Ipo8 UTSW 6 148789093 missense probably benign
R1417:Ipo8 UTSW 6 148818052 missense probably benign 0.02
R1590:Ipo8 UTSW 6 148810665 splice site probably null
R1703:Ipo8 UTSW 6 148789892 missense probably benign 0.00
R1709:Ipo8 UTSW 6 148782728 missense probably benign
R2079:Ipo8 UTSW 6 148789162 missense probably damaging 1.00
R2338:Ipo8 UTSW 6 148789823 missense probably benign 0.00
R2359:Ipo8 UTSW 6 148816477 splice site probably benign
R2696:Ipo8 UTSW 6 148796741 missense probably benign 0.01
R3407:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3408:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3709:Ipo8 UTSW 6 148806344 splice site probably null
R3710:Ipo8 UTSW 6 148806344 splice site probably null
R3945:Ipo8 UTSW 6 148818117 missense probably damaging 1.00
R4326:Ipo8 UTSW 6 148800164 unclassified probably benign
R4329:Ipo8 UTSW 6 148800164 unclassified probably benign
R6105:Ipo8 UTSW 6 148798670 missense probably damaging 1.00
R6148:Ipo8 UTSW 6 148799780 missense probably damaging 1.00
R6359:Ipo8 UTSW 6 148777250 missense probably benign 0.01
R6377:Ipo8 UTSW 6 148816497 nonsense probably null
R6724:Ipo8 UTSW 6 148809975 splice site probably null
R7283:Ipo8 UTSW 6 148824481 missense possibly damaging 0.86
R7436:Ipo8 UTSW 6 148789805 missense probably benign 0.13
R8044:Ipo8 UTSW 6 148809923 missense probably damaging 1.00
R8209:Ipo8 UTSW 6 148796678 missense possibly damaging 0.93
R8812:Ipo8 UTSW 6 148775077 missense possibly damaging 0.64
R8943:Ipo8 UTSW 6 148775049 missense probably benign 0.00
R9067:Ipo8 UTSW 6 148777232 missense probably damaging 1.00
R9129:Ipo8 UTSW 6 148798627 missense probably benign 0.05
R9297:Ipo8 UTSW 6 148801578 missense possibly damaging 0.63
R9419:Ipo8 UTSW 6 148784566 missense probably benign 0.15
Z1177:Ipo8 UTSW 6 148796712 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGACATGTTGCCCACCTC -3'
(R):5'- GAAGCATCTGACACATGGGG -3'

Sequencing Primer
(F):5'- CCTCTGCCTATCAAAGGGCTG -3'
(R):5'- TGTTTGAGTCCTCTGTGTGGTCC -3'
Posted On 2019-10-07