Incidental Mutation 'R7445:Rnf122'
ID 577232
Institutional Source Beutler Lab
Gene Symbol Rnf122
Ensembl Gene ENSMUSG00000039328
Gene Name ring finger protein 122
Synonyms 1110063C11Rik
MMRRC Submission 045521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 31601848-31621510 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31608528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 32 (D32V)
Ref Sequence ENSEMBL: ENSMUSP00000150893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046941] [ENSMUST00000217278]
AlphaFold Q8BP31
Predicted Effect possibly damaging
Transcript: ENSMUST00000046941
AA Change: D32V

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040478
Gene: ENSMUSG00000039328
AA Change: D32V

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
RING 92 132 3.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217278
AA Change: D32V

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0966 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. The encoded protein is localized to the endoplasmic reticulum and golgi apparatus, and may be associated with cell viability. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,962 (GRCm39) S233T probably damaging Het
1700034E13Rik T A 18: 52,793,553 (GRCm39) C29S probably damaging Het
Acsbg3 G A 17: 57,189,973 (GRCm39) R333Q possibly damaging Het
Ank3 A G 10: 69,827,954 (GRCm39) T2208A Het
Ap4s1 T C 12: 51,785,424 (GRCm39) L132P probably damaging Het
Ascl4 C T 10: 85,764,364 (GRCm39) R4C probably benign Het
Brd7 A T 8: 89,088,336 (GRCm39) Y18N probably damaging Het
Cacna2d3 A G 14: 28,780,575 (GRCm39) S648P possibly damaging Het
Camta1 C T 4: 151,228,748 (GRCm39) E695K possibly damaging Het
Ccdc28b A G 4: 129,516,400 (GRCm39) F53L probably benign Het
Chaf1a A G 17: 56,369,170 (GRCm39) D467G possibly damaging Het
Cnnm1 G A 19: 43,429,260 (GRCm39) R126H possibly damaging Het
Cog5 T G 12: 31,969,671 (GRCm39) S730R possibly damaging Het
Col11a1 A T 3: 113,987,578 (GRCm39) E1374D unknown Het
Csmd1 A G 8: 16,208,268 (GRCm39) I1229T possibly damaging Het
Degs1l A G 1: 180,882,577 (GRCm39) N113S possibly damaging Het
Dnajc30 T C 5: 135,093,232 (GRCm39) L43P probably damaging Het
Eif3f C T 7: 108,533,865 (GRCm39) T76M unknown Het
Ermap G A 4: 119,045,907 (GRCm39) T42I unknown Het
Gpd1l C T 9: 114,749,742 (GRCm39) G25S probably damaging Het
Heatr1 G T 13: 12,445,919 (GRCm39) W1632L possibly damaging Het
Ice1 T C 13: 70,744,286 (GRCm39) D29G Het
Ipo8 T C 6: 148,691,315 (GRCm39) D685G probably benign Het
Klra10 T C 6: 130,252,819 (GRCm39) T152A probably benign Het
Lmntd1 T A 6: 145,375,693 (GRCm39) S82C probably damaging Het
Maip1 T C 1: 57,446,190 (GRCm39) S87P possibly damaging Het
Mapkapk2 A G 1: 131,025,256 (GRCm39) S3P unknown Het
Mei4 A G 9: 81,772,292 (GRCm39) Y35C possibly damaging Het
Ms4a14 T G 19: 11,280,336 (GRCm39) K741Q probably benign Het
Mtcl3 T C 10: 29,072,999 (GRCm39) S764P possibly damaging Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Ncapg2 A G 12: 116,382,888 (GRCm39) I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 (GRCm39) M145K probably damaging Het
Nmur2 A G 11: 55,923,766 (GRCm39) F263L probably damaging Het
Ntrk2 A G 13: 58,994,576 (GRCm39) E164G probably benign Het
Or2ag1 A G 7: 106,472,549 (GRCm39) L301S possibly damaging Het
Or4c58 T A 2: 89,674,616 (GRCm39) T234S probably damaging Het
Or6c5b A T 10: 129,245,754 (GRCm39) D173V probably benign Het
P3h2 T A 16: 25,803,815 (GRCm39) Y317F probably damaging Het
Pcmtd1 C T 1: 7,190,644 (GRCm39) R38C probably damaging Het
Pcyox1 T C 6: 86,368,661 (GRCm39) T286A possibly damaging Het
Pdxk T C 10: 78,283,801 (GRCm39) D131G probably benign Het
Ppl T C 16: 4,906,932 (GRCm39) D1121G probably damaging Het
Prkra T C 2: 76,463,942 (GRCm39) D240G probably benign Het
Ptgs1 C A 2: 36,135,222 (GRCm39) N395K probably benign Het
Ptprq A T 10: 107,426,820 (GRCm39) Y1572N probably damaging Het
Pyroxd1 A T 6: 142,304,227 (GRCm39) H326L probably benign Het
Rapgef5 A G 12: 117,719,704 (GRCm39) D778G probably benign Het
Rbm46 T A 3: 82,771,517 (GRCm39) E366V probably damaging Het
Rnd1 G T 15: 98,568,550 (GRCm39) H209Q probably benign Het
Samd4b G A 7: 28,105,881 (GRCm39) P446S probably benign Het
Slco1a5 C A 6: 142,204,734 (GRCm39) A187S possibly damaging Het
Smarca4 G A 9: 21,597,543 (GRCm39) V1436M probably damaging Het
Smok2a G A 17: 13,445,526 (GRCm39) G368R possibly damaging Het
Smok3c T A 5: 138,062,757 (GRCm39) H81Q probably damaging Het
Stk16 T C 1: 75,190,296 (GRCm39) V245A probably damaging Het
Svep1 A T 4: 58,094,122 (GRCm39) N1505K possibly damaging Het
Tigd4 G A 3: 84,502,471 (GRCm39) A463T probably benign Het
Tmem117 T C 15: 94,612,799 (GRCm39) F112L probably benign Het
Tmem72 A G 6: 116,675,291 (GRCm39) I67T probably benign Het
Tnik A G 3: 28,718,058 (GRCm39) probably null Het
Trav14-2 A G 14: 53,878,515 (GRCm39) Q66R probably damaging Het
Trpv6 T A 6: 41,598,276 (GRCm39) D677V probably damaging Het
Vgll4 C T 6: 114,839,157 (GRCm39) S278N unknown Het
Wdfy4 C T 14: 32,792,575 (GRCm39) W2157* probably null Het
Other mutations in Rnf122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rnf122 APN 8 31,614,908 (GRCm39) nonsense probably null
IGL01545:Rnf122 APN 8 31,618,630 (GRCm39) missense probably damaging 0.97
R0109:Rnf122 UTSW 8 31,614,877 (GRCm39) splice site probably benign
R1263:Rnf122 UTSW 8 31,602,177 (GRCm39) start codon destroyed probably null 0.01
R1961:Rnf122 UTSW 8 31,614,874 (GRCm39) splice site probably benign
R2164:Rnf122 UTSW 8 31,602,192 (GRCm39) nonsense probably null
R4369:Rnf122 UTSW 8 31,602,177 (GRCm39) start codon destroyed probably null 0.00
R4488:Rnf122 UTSW 8 31,618,283 (GRCm39) missense probably damaging 0.98
R4964:Rnf122 UTSW 8 31,602,177 (GRCm39) start codon destroyed probably null 0.00
R6983:Rnf122 UTSW 8 31,608,488 (GRCm39) missense probably benign
R8049:Rnf122 UTSW 8 31,618,608 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTTCTTCGGGACCAGGTAG -3'
(R):5'- GGGTCACCTTGCTCAATATCC -3'

Sequencing Primer
(F):5'- CGGGACCAGGTAGCTTGTAG -3'
(R):5'- GGTCACCTTGCTCAATATCCTTTATG -3'
Posted On 2019-10-07