Mutagenetix > Incidental Mutations

Incidental Mutation 'R7445:Brd7'

577233

Institutional Source

Beutler Lab

Gene Symbol

Brd7

Ensembl Gene

ENSMUSG00000031660

Gene Name

bromodomain containing 7

Synonyms

bromodomain protein 75 kDa, CELTIX1, BP75

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88331039-88362194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88361708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 18 (Y18N)

Ref Sequence

ENSEMBL: ENSMUSP00000034085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034085]

AlphaFold

O88665

Predicted Effect

probably damaging
Transcript: ENSMUST00000034085
AA Change: Y18N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000034085
Gene: ENSMUSG00000031660
AA Change: Y18N

Domain	Start	End	E-Value	Type
low complexity region	51	68	N/A	INTRINSIC
low complexity region	76	96	N/A	INTRINSIC
BROMO	129	237	9.72e-38	SMART
Pfam:DUF3512	287	534	2.4e-93	PFAM
coiled coil region	535	564	N/A	INTRINSIC

Meta Mutation Damage Score

0.1081

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cognitive behavior and dendrite morphology in the medial prefrontal cortex. Mice homozygous for a different knock-out allele die in utero prior to E16.5, showing fetal growth retardation and altered limb, blood vessel and organ development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Brd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01947:Brd7	APN	8	88332875	unclassified	probably benign
IGL02172:Brd7	APN	8	88351824	missense	probably benign	0.41
IGL02441:Brd7	APN	8	88343590	missense	probably damaging	1.00
R0241:Brd7	UTSW	8	88345850	missense	probably benign	0.01
R0241:Brd7	UTSW	8	88345850	missense	probably benign	0.01
R0845:Brd7	UTSW	8	88342767	nonsense	probably null
R1613:Brd7	UTSW	8	88346950	missense	probably benign	0.00
R1659:Brd7	UTSW	8	88333792	missense	probably damaging	1.00
R1663:Brd7	UTSW	8	88358023	missense	possibly damaging	0.87
R2237:Brd7	UTSW	8	88346913	missense	probably benign	0.22
R2280:Brd7	UTSW	8	88342757	missense	probably benign	0.00
R2916:Brd7	UTSW	8	88342780	missense	probably damaging	0.98
R2917:Brd7	UTSW	8	88342780	missense	probably damaging	0.98
R3770:Brd7	UTSW	8	88339407	critical splice donor site	probably null
R4030:Brd7	UTSW	8	88332931	missense	probably damaging	1.00
R5287:Brd7	UTSW	8	88357541	missense	probably damaging	1.00
R5403:Brd7	UTSW	8	88357541	missense	probably damaging	1.00
R6333:Brd7	UTSW	8	88345191	missense	probably damaging	1.00
R7021:Brd7	UTSW	8	88347004	missense	probably benign	0.00
R7072:Brd7	UTSW	8	88346987	missense	probably benign
R7482:Brd7	UTSW	8	88361626	missense	probably damaging	0.99
R7977:Brd7	UTSW	8	88334141	missense	probably benign
R7987:Brd7	UTSW	8	88334141	missense	probably benign
R8205:Brd7	UTSW	8	88343615	missense	probably damaging	1.00
R8814:Brd7	UTSW	8	88345154	missense	probably benign	0.00
R8984:Brd7	UTSW	8	88354712	missense	probably benign	0.00
R9190:Brd7	UTSW	8	88354646	missense	probably damaging	1.00
R9296:Brd7	UTSW	8	88332932	missense	possibly damaging	0.46
X0067:Brd7	UTSW	8	88343697	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGGACAAGACTTGCTGAGC -3'
(R):5'- ACTTCTACGAGGGTGAGGAG -3'

Sequencing Primer
(F):5'- CAGACTTCCCAGACGTCTG -3'
(R):5'- GAGGAGCGGCTGGCCTG -3'

Posted On

2019-10-07