Mutagenetix > Incidental Mutations

Incidental Mutation 'R7445:Ptprq'

577241

Institutional Source

Beutler Lab

Gene Symbol

Ptprq

Ensembl Gene

ENSMUSG00000035916

Gene Name

protein tyrosine phosphatase, receptor type, Q

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107517049-107720051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107590959 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1572 (Y1572N)

Ref Sequence

ENSEMBL: ENSMUSP00000058572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050702]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050702
AA Change: Y1572N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: Y1572N

Domain	Start	End	E-Value	Type
FN3	57	141	3.17e-13	SMART
FN3	156	294	1.55e-7	SMART
FN3	307	384	4.45e-8	SMART
FN3	398	555	1.17e-7	SMART
FN3	569	648	7.06e-11	SMART
FN3	666	743	7.68e-12	SMART
FN3	760	839	1.88e-6	SMART
FN3	855	932	1.33e-6	SMART
FN3	949	1037	2.31e-6	SMART
FN3	1054	1135	1.24e-6	SMART
FN3	1151	1229	2.39e-8	SMART
FN3	1244	1325	6.29e-8	SMART
FN3	1341	1416	2.87e-11	SMART
FN3	1431	1524	2.82e-10	SMART
FN3	1540	1622	6.35e-4	SMART
FN3	1642	1732	7.93e-5	SMART
transmembrane domain	1907	1929	N/A	INTRINSIC
PTPc	2003	2262	1.14e-130	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Ptprq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptprq	APN	10	107576929	missense	probably damaging	0.98
IGL00537:Ptprq	APN	10	107710522	missense	probably benign	0.07
IGL00547:Ptprq	APN	10	107718541	missense	probably damaging	0.99
IGL00586:Ptprq	APN	10	107608122	splice site	probably benign
IGL00648:Ptprq	APN	10	107646716	missense	probably benign	0.10
IGL01123:Ptprq	APN	10	107686218	missense	probably damaging	0.96
IGL01343:Ptprq	APN	10	107638839	missense	probably damaging	0.96
IGL01348:Ptprq	APN	10	107711904	missense	probably damaging	1.00
IGL01433:Ptprq	APN	10	107576880	missense	probably damaging	0.99
IGL01510:Ptprq	APN	10	107712048	missense	probably damaging	1.00
IGL01535:Ptprq	APN	10	107699596	missense	probably benign
IGL01631:Ptprq	APN	10	107643538	missense	probably benign	0.00
IGL01633:Ptprq	APN	10	107699723	splice site	probably benign
IGL01702:Ptprq	APN	10	107517866	missense	probably benign	0.00
IGL01733:Ptprq	APN	10	107662599	missense	probably benign	0.10
IGL01806:Ptprq	APN	10	107699608	missense	probably damaging	1.00
IGL01832:Ptprq	APN	10	107565839	critical splice donor site	probably null
IGL01961:Ptprq	APN	10	107643654	missense	probably damaging	1.00
IGL02108:Ptprq	APN	10	107646617	missense	probably damaging	1.00
IGL02120:Ptprq	APN	10	107667472	missense	probably damaging	1.00
IGL02160:Ptprq	APN	10	107653565	missense	probably benign	0.00
IGL02178:Ptprq	APN	10	107686319	missense	probably benign	0.03
IGL02249:Ptprq	APN	10	107582359	missense	probably damaging	1.00
IGL02267:Ptprq	APN	10	107646558	missense	probably damaging	1.00
IGL02527:Ptprq	APN	10	107686563	missense	probably benign	0.04
IGL02529:Ptprq	APN	10	107635365	missense	probably benign	0.03
IGL02542:Ptprq	APN	10	107662555	missense	probably damaging	1.00
IGL02582:Ptprq	APN	10	107643999	missense	probably benign	0.00
IGL02708:Ptprq	APN	10	107652700	missense	probably damaging	1.00
IGL02894:Ptprq	APN	10	107667424	missense	probably benign
IGL02903:Ptprq	APN	10	107666586	missense	possibly damaging	0.51
IGL02951:Ptprq	APN	10	107667460	missense	probably benign	0.03
IGL02982:Ptprq	APN	10	107586684	missense	probably damaging	1.00
IGL03000:Ptprq	APN	10	107542657	missense	probably damaging	1.00
IGL03024:Ptprq	APN	10	107685566	missense	possibly damaging	0.69
IGL03240:Ptprq	APN	10	107688507	missense	probably benign
P0043:Ptprq	UTSW	10	107580225	missense	probably benign	0.03
PIT4812001:Ptprq	UTSW	10	107666567	missense	probably damaging	1.00
R0200:Ptprq	UTSW	10	107685157	missense	probably benign
R0268:Ptprq	UTSW	10	107705548	missense	probably benign
R0276:Ptprq	UTSW	10	107542735	critical splice acceptor site	probably null
R0279:Ptprq	UTSW	10	107608417	missense	probably damaging	0.96
R0335:Ptprq	UTSW	10	107708728	missense	probably benign
R0344:Ptprq	UTSW	10	107705582	missense	probably benign
R0357:Ptprq	UTSW	10	107686199	splice site	probably benign
R0454:Ptprq	UTSW	10	107582530	nonsense	probably null
R0479:Ptprq	UTSW	10	107643994	nonsense	probably null
R0491:Ptprq	UTSW	10	107608175	missense	probably damaging	0.98
R0519:Ptprq	UTSW	10	107538920	splice site	probably benign
R0523:Ptprq	UTSW	10	107580220	missense	possibly damaging	0.54
R0553:Ptprq	UTSW	10	107710627	missense	probably benign	0.33
R0746:Ptprq	UTSW	10	107517831	missense	probably damaging	1.00
R0755:Ptprq	UTSW	10	107582539	missense	probably benign	0.09
R1434:Ptprq	UTSW	10	107586714	missense	probably damaging	1.00
R1445:Ptprq	UTSW	10	107662562	missense	probably damaging	1.00
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1470:Ptprq	UTSW	10	107718574	missense	probably damaging	0.97
R1558:Ptprq	UTSW	10	107644043	missense	probably damaging	1.00
R1567:Ptprq	UTSW	10	107565887	missense	probably benign	0.13
R1711:Ptprq	UTSW	10	107534699	nonsense	probably null
R1720:Ptprq	UTSW	10	107686294	missense	probably damaging	1.00
R1746:Ptprq	UTSW	10	107638830	missense	probably damaging	1.00
R1776:Ptprq	UTSW	10	107685089	missense	probably damaging	1.00
R1822:Ptprq	UTSW	10	107718478	missense	probably damaging	1.00
R1872:Ptprq	UTSW	10	107643999	missense	probably benign	0.19
R1944:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R1945:Ptprq	UTSW	10	107582388	missense	probably benign	0.23
R2006:Ptprq	UTSW	10	107666546	missense	probably damaging	1.00
R2014:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2015:Ptprq	UTSW	10	107667422	missense	probably damaging	0.96
R2097:Ptprq	UTSW	10	107653493	missense	probably benign	0.05
R2172:Ptprq	UTSW	10	107590994	nonsense	probably null
R2174:Ptprq	UTSW	10	107705553	missense	probably damaging	1.00
R2248:Ptprq	UTSW	10	107643070	splice site	probably null
R2404:Ptprq	UTSW	10	107686599	missense	probably damaging	1.00
R3423:Ptprq	UTSW	10	107582476	missense	probably damaging	0.99
R3683:Ptprq	UTSW	10	107708628	missense	probably benign	0.01
R3875:Ptprq	UTSW	10	107685104	missense	possibly damaging	0.88
R3945:Ptprq	UTSW	10	107686392	splice site	probably benign
R3946:Ptprq	UTSW	10	107686392	splice site	probably benign
R3974:Ptprq	UTSW	10	107712062	missense	possibly damaging	0.88
R3982:Ptprq	UTSW	10	107543396	missense	probably damaging	0.99
R4105:Ptprq	UTSW	10	107572967	missense	probably damaging	1.00
R4118:Ptprq	UTSW	10	107711920	missense	probably benign	0.37
R4175:Ptprq	UTSW	10	107711917	missense	probably benign
R4231:Ptprq	UTSW	10	107686283	nonsense	probably null
R4356:Ptprq	UTSW	10	107608364	missense	probably damaging	0.99
R4435:Ptprq	UTSW	10	107685055	missense	possibly damaging	0.89
R4678:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4679:Ptprq	UTSW	10	107685182	missense	probably benign	0.19
R4745:Ptprq	UTSW	10	107524253	missense	probably damaging	1.00
R4771:Ptprq	UTSW	10	107688427	missense	probably benign
R4778:Ptprq	UTSW	10	107591022	missense	probably benign	0.15
R4808:Ptprq	UTSW	10	107718507	missense	probably damaging	1.00
R4809:Ptprq	UTSW	10	107563175	missense	probably damaging	1.00
R4818:Ptprq	UTSW	10	107710581	missense	possibly damaging	0.86
R4845:Ptprq	UTSW	10	107653532	missense	probably benign	0.00
R4901:Ptprq	UTSW	10	107688414	missense	probably benign	0.01
R4942:Ptprq	UTSW	10	107688429	missense	probably benign	0.01
R4946:Ptprq	UTSW	10	107525734	missense	probably benign
R4959:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R4973:Ptprq	UTSW	10	107686555	missense	probably damaging	1.00
R5007:Ptprq	UTSW	10	107608276	missense	probably benign	0.00
R5053:Ptprq	UTSW	10	107563202	missense	probably damaging	1.00
R5055:Ptprq	UTSW	10	107534679	missense	probably benign	0.37
R5090:Ptprq	UTSW	10	107526089	missense	probably damaging	1.00
R5158:Ptprq	UTSW	10	107534704	missense	probably damaging	1.00
R5163:Ptprq	UTSW	10	107524331	missense	probably damaging	1.00
R5222:Ptprq	UTSW	10	107662564	missense	probably damaging	0.96
R5244:Ptprq	UTSW	10	107586695	missense	possibly damaging	0.62
R5249:Ptprq	UTSW	10	107699635	missense	probably damaging	0.99
R5503:Ptprq	UTSW	10	107688328	splice site	probably null
R5508:Ptprq	UTSW	10	107686231	missense	probably benign	0.00
R5601:Ptprq	UTSW	10	107608430	missense	probably benign
R5722:Ptprq	UTSW	10	107686365	missense	possibly damaging	0.72
R5819:Ptprq	UTSW	10	107719883	start gained	probably benign
R5862:Ptprq	UTSW	10	107565878	missense	probably benign	0.02
R5891:Ptprq	UTSW	10	107576895	missense	possibly damaging	0.94
R5916:Ptprq	UTSW	10	107523513	missense	probably damaging	1.00
R6054:Ptprq	UTSW	10	107582358	missense	probably damaging	1.00
R6058:Ptprq	UTSW	10	107635274	missense	probably benign	0.00
R6075:Ptprq	UTSW	10	107525760	missense	probably damaging	1.00
R6101:Ptprq	UTSW	10	107580266	missense	possibly damaging	0.93
R6189:Ptprq	UTSW	10	107517887	missense	probably damaging	1.00
R6235:Ptprq	UTSW	10	107635338	missense	possibly damaging	0.61
R6351:Ptprq	UTSW	10	107708668	missense	probably damaging	0.99
R6394:Ptprq	UTSW	10	107642943	nonsense	probably null
R6449:Ptprq	UTSW	10	107705583	missense	probably benign	0.00
R6526:Ptprq	UTSW	10	107542653	nonsense	probably null
R6544:Ptprq	UTSW	10	107608241	missense	probably damaging	1.00
R6609:Ptprq	UTSW	10	107572968	missense	probably damaging	0.99
R6862:Ptprq	UTSW	10	107686225	missense	probably damaging	0.96
R6874:Ptprq	UTSW	10	107718599	missense	possibly damaging	0.80
R6892:Ptprq	UTSW	10	107576004	missense	probably benign	0.00
R7082:Ptprq	UTSW	10	107708730	missense	probably benign	0.10
R7210:Ptprq	UTSW	10	107685171	missense	probably damaging	1.00
R7253:Ptprq	UTSW	10	107608273	missense	probably benign	0.30
R7293:Ptprq	UTSW	10	107635506	nonsense	probably null
R7632:Ptprq	UTSW	10	107711922	missense	probably benign	0.32
R7685:Ptprq	UTSW	10	107643978	missense	probably damaging	1.00
R7703:Ptprq	UTSW	10	107644146	missense	probably benign	0.01
R7774:Ptprq	UTSW	10	107643669	missense	probably damaging	0.96
R7897:Ptprq	UTSW	10	107710623	missense	probably benign	0.21
R7936:Ptprq	UTSW	10	107652711	missense	probably damaging	1.00
R7983:Ptprq	UTSW	10	107608411	nonsense	probably null
R8023:Ptprq	UTSW	10	107652616	nonsense	probably null
R8071:Ptprq	UTSW	10	107644035	missense	possibly damaging	0.62
R8084:Ptprq	UTSW	10	107608433	missense	probably benign
R8086:Ptprq	UTSW	10	107646639	nonsense	probably null
R8169:Ptprq	UTSW	10	107582490	missense	probably damaging	1.00
R8223:Ptprq	UTSW	10	107699638	missense	probably benign	0.00
R8235:Ptprq	UTSW	10	107582541	missense	probably damaging	1.00
R8235:Ptprq	UTSW	10	107705490	missense	probably benign	0.32
R8278:Ptprq	UTSW	10	107686378	missense	possibly damaging	0.87
Z1088:Ptprq	UTSW	10	107699672	missense	possibly damaging	0.56
Z1176:Ptprq	UTSW	10	107526070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATATGGTCAACAGCCCAAGC -3'
(R):5'- CCAGTCTTAAGATTAACTTTCAGTGCG -3'

Sequencing Primer
(F):5'- CAAGCTGAACAATCTATCTAAGGTC -3'
(R):5'- AACTTTCAGTGCGTTTATGATCTG -3'

Posted On

2019-10-07