Incidental Mutation 'R7445:Nmur2'
ID 577243
Institutional Source Beutler Lab
Gene Symbol Nmur2
Ensembl Gene ENSMUSG00000037393
Gene Name neuromedin U receptor 2
Synonyms
MMRRC Submission 045521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 56024987-56041010 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56032940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 263 (F263L)
Ref Sequence ENSEMBL: ENSMUSP00000044718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037682]
AlphaFold Q8BZ39
Predicted Effect probably damaging
Transcript: ENSMUST00000037682
AA Change: F263L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: F263L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 337 4.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 48 334 1.8e-13 PFAM
Pfam:7tm_1 54 319 5.7e-51 PFAM
Meta Mutation Damage Score 0.1383 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Nmur2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nmur2 APN 11 56040777 missense probably damaging 0.99
IGL01591:Nmur2 APN 11 56026999 missense probably benign
IGL01960:Nmur2 APN 11 56040511 missense probably damaging 0.99
IGL02108:Nmur2 APN 11 56040364 missense probably benign 0.33
IGL02602:Nmur2 APN 11 56027063 missense probably benign 0.19
PIT4677001:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R0324:Nmur2 UTSW 11 56040520 missense probably damaging 1.00
R0458:Nmur2 UTSW 11 56040568 missense possibly damaging 0.93
R0718:Nmur2 UTSW 11 56029498 splice site probably benign
R1799:Nmur2 UTSW 11 56029621 missense probably damaging 1.00
R2099:Nmur2 UTSW 11 56040763 missense probably benign 0.00
R2263:Nmur2 UTSW 11 56029561 missense probably damaging 0.97
R3701:Nmur2 UTSW 11 56040777 missense probably damaging 0.99
R3705:Nmur2 UTSW 11 56040474 missense probably damaging 1.00
R3951:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4083:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4744:Nmur2 UTSW 11 56040835 missense probably benign 0.01
R4747:Nmur2 UTSW 11 56040279 missense probably benign 0.05
R5288:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5384:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5579:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R6329:Nmur2 UTSW 11 56029585 missense probably benign 0.30
R6477:Nmur2 UTSW 11 56029591 missense probably damaging 1.00
R7580:Nmur2 UTSW 11 56026982 missense probably benign 0.03
R7899:Nmur2 UTSW 11 56040335 missense probably benign
R8688:Nmur2 UTSW 11 56040828 missense probably damaging 1.00
R9090:Nmur2 UTSW 11 56040482 missense probably benign 0.44
R9098:Nmur2 UTSW 11 56029582 missense possibly damaging 0.93
R9271:Nmur2 UTSW 11 56040482 missense probably benign 0.44
R9542:Nmur2 UTSW 11 56040823 missense probably damaging 0.98
X0062:Nmur2 UTSW 11 56040849 missense probably benign 0.01
Z1176:Nmur2 UTSW 11 56027101 missense probably benign 0.12
Z1186:Nmur2 UTSW 11 56040278 missense probably benign
Z1187:Nmur2 UTSW 11 56040278 missense probably benign
Z1188:Nmur2 UTSW 11 56040278 missense probably benign
Z1189:Nmur2 UTSW 11 56040278 missense probably benign
Z1190:Nmur2 UTSW 11 56040278 missense probably benign
Z1191:Nmur2 UTSW 11 56040278 missense probably benign
Z1192:Nmur2 UTSW 11 56040278 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGCACCATTACGTCAG -3'
(R):5'- TGAATTCTGCCTCCAGTGAAG -3'

Sequencing Primer
(F):5'- GCACCATTACGTCAGTACCAAAG -3'
(R):5'- CCTCCAGTGAAGTGTTTAAATTTTTC -3'
Posted On 2019-10-07