Mutagenetix > Incidental Mutations

Incidental Mutation 'R7445:Ncapg2'

577246

Institutional Source

Beutler Lab

Gene Symbol

Ncapg2

Ensembl Gene

ENSMUSG00000042029

Gene Name

non-SMC condensin II complex, subunit G2

Synonyms

Luzp5, 5830426I05Rik, mCAP-G2, Mtb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116405402-116463731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116419268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 240 (I240V)

Ref Sequence

ENSEMBL: ENSMUSP00000081889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084828]

AlphaFold

Q6DFV1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084828
AA Change: I240V

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: I240V

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
Pfam:Condensin2nSMC	212	361	7.2e-62	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Ntrk2	A	G	13: 58,846,762	E164G	probably benign	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Ncapg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Ncapg2	APN	12	116424650	missense	possibly damaging	0.54
IGL01694:Ncapg2	APN	12	116407230	utr 5 prime	probably benign
IGL01724:Ncapg2	APN	12	116426711	missense	probably damaging	1.00
IGL01792:Ncapg2	APN	12	116425818	missense	probably damaging	0.99
IGL02098:Ncapg2	APN	12	116444332	missense	possibly damaging	0.59
IGL02136:Ncapg2	APN	12	116460583	missense	probably benign
IGL02409:Ncapg2	APN	12	116420717	missense	probably damaging	1.00
IGL02580:Ncapg2	APN	12	116420689	missense	probably damaging	1.00
IGL02653:Ncapg2	APN	12	116425906	critical splice donor site	probably null
IGL03073:Ncapg2	APN	12	116452274	missense	probably benign	0.01
IGL03114:Ncapg2	APN	12	116452373	splice site	probably benign
IGL03199:Ncapg2	APN	12	116419236	missense	probably damaging	1.00
IGL03328:Ncapg2	APN	12	116440057	missense	possibly damaging	0.90
P0033:Ncapg2	UTSW	12	116438635	missense	probably benign	0.03
R0008:Ncapg2	UTSW	12	116429835	missense	probably damaging	1.00
R0194:Ncapg2	UTSW	12	116420683	splice site	probably null
R0379:Ncapg2	UTSW	12	116443075	missense	probably damaging	1.00
R0568:Ncapg2	UTSW	12	116423215	missense	probably damaging	1.00
R0771:Ncapg2	UTSW	12	116413159	nonsense	probably null
R1016:Ncapg2	UTSW	12	116438675	missense	probably damaging	1.00
R1507:Ncapg2	UTSW	12	116460566	missense	probably benign	0.00
R1524:Ncapg2	UTSW	12	116434578	splice site	probably benign
R1596:Ncapg2	UTSW	12	116419236	missense	probably damaging	1.00
R1635:Ncapg2	UTSW	12	116434685	frame shift	probably null
R1752:Ncapg2	UTSW	12	116426718	missense	probably damaging	1.00
R2164:Ncapg2	UTSW	12	116450475	splice site	probably null
R2266:Ncapg2	UTSW	12	116429676	missense	probably damaging	1.00
R2366:Ncapg2	UTSW	12	116420729	nonsense	probably null
R2924:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R2925:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R3828:Ncapg2	UTSW	12	116407318	splice site	probably benign
R3829:Ncapg2	UTSW	12	116407318	splice site	probably benign
R4384:Ncapg2	UTSW	12	116439877	critical splice donor site	probably null
R4651:Ncapg2	UTSW	12	116425787	missense	probably damaging	1.00
R4701:Ncapg2	UTSW	12	116440618	missense	probably benign
R4821:Ncapg2	UTSW	12	116415457	missense	probably damaging	0.99
R4845:Ncapg2	UTSW	12	116440588	missense	probably damaging	0.96
R5135:Ncapg2	UTSW	12	116427786	missense	possibly damaging	0.64
R5294:Ncapg2	UTSW	12	116427794	missense	possibly damaging	0.54
R5334:Ncapg2	UTSW	12	116426637	missense	probably damaging	1.00
R5588:Ncapg2	UTSW	12	116413077	missense	possibly damaging	0.95
R5888:Ncapg2	UTSW	12	116425800	missense	possibly damaging	0.84
R5938:Ncapg2	UTSW	12	116429657	missense	probably damaging	1.00
R5978:Ncapg2	UTSW	12	116424671	missense	possibly damaging	0.68
R6016:Ncapg2	UTSW	12	116426607	missense	probably damaging	1.00
R6026:Ncapg2	UTSW	12	116443021	missense	possibly damaging	0.73
R6155:Ncapg2	UTSW	12	116438011	missense	possibly damaging	0.83
R6509:Ncapg2	UTSW	12	116427756	missense	probably damaging	1.00
R6675:Ncapg2	UTSW	12	116434661	missense	possibly damaging	0.71
R6912:Ncapg2	UTSW	12	116426582	missense	probably benign
R7069:Ncapg2	UTSW	12	116424717	splice site	probably null
R7339:Ncapg2	UTSW	12	116414834	missense	probably damaging	0.96
R7440:Ncapg2	UTSW	12	116450413	missense	possibly damaging	0.89
R7704:Ncapg2	UTSW	12	116419277	missense	probably damaging	1.00
R8061:Ncapg2	UTSW	12	116426577	missense	probably benign
R8132:Ncapg2	UTSW	12	116444347	missense	possibly damaging	0.93
R8166:Ncapg2	UTSW	12	116412416	missense	probably benign	0.00
R8351:Ncapg2	UTSW	12	116440027	missense	possibly damaging	0.80
R8526:Ncapg2	UTSW	12	116440059	missense	probably benign	0.00
R8692:Ncapg2	UTSW	12	116450429	missense	probably damaging	1.00
R8739:Ncapg2	UTSW	12	116415478	missense	possibly damaging	0.75
R8766:Ncapg2	UTSW	12	116426736	missense	probably damaging	1.00
R8929:Ncapg2	UTSW	12	116452363	missense	probably damaging	1.00
R9046:Ncapg2	UTSW	12	116412525	missense	probably benign	0.01
R9187:Ncapg2	UTSW	12	116438667	missense	probably damaging	1.00
R9344:Ncapg2	UTSW	12	116424653	missense	probably damaging	1.00
R9444:Ncapg2	UTSW	12	116407243	missense	probably damaging	1.00
X0020:Ncapg2	UTSW	12	116424707	missense	probably damaging	1.00
Z1177:Ncapg2	UTSW	12	116438605	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGTGATACTGACTTGGGCTTC -3'
(R):5'- AGACTGGAGATCAACCTGGG -3'

Sequencing Primer
(F):5'- GGGCTTCATTTTTATAAATAGCTGAC -3'
(R):5'- GGGCTACATATCAAGACCTTGTC -3'

Posted On

2019-10-07