Incidental Mutation 'R7445:Rapgef5'
ID 577247
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene Name Rap guanine nucleotide exchange factor (GEF) 5
Synonyms D030051B22Rik, mr-gef
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7445 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 117516479-117759737 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117755969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 778 (D778G)
Ref Sequence ENSEMBL: ENSMUSP00000105313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
AlphaFold Q8C0Q9
Predicted Effect probably benign
Transcript: ENSMUST00000109691
AA Change: D778G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: D778G

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222105
AA Change: D576G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222185
AA Change: D544G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117714182 missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117721380 missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117753419 splice site probably benign
IGL01720:Rapgef5 APN 12 117613435 splice site probably benign
IGL01958:Rapgef5 APN 12 117730651 missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117719132 missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117742872 missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117730559 missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117748441 missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117721299 missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117688676 missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117647121 splice site probably benign
R1331:Rapgef5 UTSW 12 117721349 missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117688619 missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117647101 missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117595291 missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117658320 missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117688684 critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117584119 nonsense probably null
R2117:Rapgef5 UTSW 12 117714064 splice site probably null
R2169:Rapgef5 UTSW 12 117715395 missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117714119 missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117728670 missense possibly damaging 0.49
R4004:Rapgef5 UTSW 12 117748397 missense probably damaging 0.99
R4652:Rapgef5 UTSW 12 117714128 missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117756074 missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117739644 missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117688611 missense probably benign 0.24
R5456:Rapgef5 UTSW 12 117728646 splice site probably null
R5502:Rapgef5 UTSW 12 117721329 missense probably damaging 1.00
R5741:Rapgef5 UTSW 12 117756029 missense probably damaging 0.99
R5771:Rapgef5 UTSW 12 117721326 missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117748426 missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117728738 missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117721663 splice site probably null
R6233:Rapgef5 UTSW 12 117739718 critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117721253 missense probably damaging 1.00
R6475:Rapgef5 UTSW 12 117718207 missense probably damaging 1.00
R7063:Rapgef5 UTSW 12 117689129 missense possibly damaging 0.91
R7410:Rapgef5 UTSW 12 117721328 missense probably damaging 1.00
R7690:Rapgef5 UTSW 12 117721370 missense possibly damaging 0.72
R7707:Rapgef5 UTSW 12 117715344 missense probably damaging 1.00
R7815:Rapgef5 UTSW 12 117755967 missense probably benign 0.10
R8461:Rapgef5 UTSW 12 117714109 missense probably benign 0.00
R8475:Rapgef5 UTSW 12 117718230 missense probably damaging 0.99
R8675:Rapgef5 UTSW 12 117584162 missense probably damaging 1.00
R8682:Rapgef5 UTSW 12 117581812 missense probably benign 0.06
R9018:Rapgef5 UTSW 12 117748397 missense probably damaging 0.99
X0018:Rapgef5 UTSW 12 117718215 missense probably damaging 1.00
Z1176:Rapgef5 UTSW 12 117595288 missense probably damaging 1.00
Z1177:Rapgef5 UTSW 12 117688997 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCCAGTAAATATGAGTCAGCC -3'
(R):5'- GCACTTGTCTCATGGTATGCTG -3'

Sequencing Primer
(F):5'- TATGAGTCAGCCTGCATGAGC -3'
(R):5'- CAGCAACCTCTTTTATTACAGGAAGC -3'
Posted On 2019-10-07