Mutagenetix > Incidental Mutation

Incidental Mutation 'R7445:Ntrk2'

577249

Institutional Source

Beutler Lab

Gene Symbol

Ntrk2

Ensembl Gene

ENSMUSG00000055254

Gene Name

neurotrophic tyrosine kinase, receptor, type 2

Synonyms

C030027L06Rik, Tkrb, trkB

MMRRC Submission

045521-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.884) question?

Stock #

R7445 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58806569-59133970 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58846762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 164 (E164G)

Ref Sequence

ENSEMBL: ENSMUSP00000078757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000109838] [ENSMUST00000224259] [ENSMUST00000224402] [ENSMUST00000225488] [ENSMUST00000225583] [ENSMUST00000225950]

AlphaFold

P15209

Predicted Effect

probably benign
Transcript: ENSMUST00000079828
AA Change: E164G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: E164G

Domain	Start	End	E-Value	Type
LRRNT	31	65	1.74e-4	SMART
LRRCT	148	195	8.56e-10	SMART
IGc2	209	273	4.43e-5	SMART
Pfam:I-set	298	377	1.2e-8	PFAM
transmembrane domain	431	453	N/A	INTRINSIC
TyrKc	537	806	2.48e-142	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109838
AA Change: E164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105464
Gene: ENSMUSG00000055254
AA Change: E164G

Domain	Start	End	E-Value	Type
LRRNT	31	65	1.74e-4	SMART
LRRCT	148	195	8.56e-10	SMART
IGc2	209	273	4.43e-5	SMART
Pfam:I-set	298	377	1.1e-8	PFAM
Pfam:Ig_2	300	377	5.4e-4	PFAM
transmembrane domain	431	453	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224259
AA Change: E164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224402
AA Change: E164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225488
AA Change: E164G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225583
AA Change: E164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225950
AA Change: E164G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,619	S233T	probably damaging	Het
1700034E13Rik	T	A	18: 52,660,481	C29S	probably damaging	Het
1700061G19Rik	G	A	17: 56,882,973	R333Q	possibly damaging	Het
9130409I23Rik	A	G	1: 181,055,012	N113S	possibly damaging	Het
Ank3	A	G	10: 69,992,124	T2208A		Het
Ap4s1	T	C	12: 51,738,641	L132P	probably damaging	Het
Ascl4	C	T	10: 85,928,500	R4C	probably benign	Het
Brd7	A	T	8: 88,361,708	Y18N	probably damaging	Het
Cacna2d3	A	G	14: 29,058,618	S648P	possibly damaging	Het
Camta1	C	T	4: 151,144,291	E695K	possibly damaging	Het
Ccdc28b	A	G	4: 129,622,607	F53L	probably benign	Het
Chaf1a	A	G	17: 56,062,170	D467G	possibly damaging	Het
Cnnm1	G	A	19: 43,440,821	R126H	possibly damaging	Het
Cog5	T	G	12: 31,919,672	S730R	possibly damaging	Het
Col11a1	A	T	3: 114,193,929	E1374D	unknown	Het
Csmd1	A	G	8: 16,158,254	I1229T	possibly damaging	Het
Dnajc30	T	C	5: 135,064,378	L43P	probably damaging	Het
Eif3f	C	T	7: 108,934,658	T76M	unknown	Het
Ermap	G	A	4: 119,188,710	T42I	unknown	Het
Gpd1l	C	T	9: 114,920,674	G25S	probably damaging	Het
Heatr1	G	T	13: 12,431,038	W1632L	possibly damaging	Het
Ice1	T	C	13: 70,596,167	D29G		Het
Ipo8	T	C	6: 148,789,817	D685G	probably benign	Het
Klra10	T	C	6: 130,275,856	T152A	probably benign	Het
Lmntd1	T	A	6: 145,429,967	S82C	probably damaging	Het
Maip1	T	C	1: 57,407,031	S87P	possibly damaging	Het
Mapkapk2	A	G	1: 131,097,519	S3P	unknown	Het
Mei4	A	G	9: 81,890,239	Y35C	possibly damaging	Het
Ms4a14	T	G	19: 11,302,972	K741Q	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ncapg2	A	G	12: 116,419,268	I240V	possibly damaging	Het
Ncbp1	T	A	4: 46,149,914	M145K	probably damaging	Het
Nmur2	A	G	11: 56,032,940	F263L	probably damaging	Het
Olfr48	T	A	2: 89,844,272	T234S	probably damaging	Het
Olfr705	A	G	7: 106,873,342	L301S	possibly damaging	Het
Olfr785	A	T	10: 129,409,885	D173V	probably benign	Het
P3h2	T	A	16: 25,985,065	Y317F	probably damaging	Het
Pcmtd1	C	T	1: 7,120,420	R38C	probably damaging	Het
Pcyox1	T	C	6: 86,391,679	T286A	possibly damaging	Het
Pdxk	T	C	10: 78,447,967	D131G	probably benign	Het
Ppl	T	C	16: 5,089,068	D1121G	probably damaging	Het
Prkra	T	C	2: 76,633,598	D240G	probably benign	Het
Ptgs1	C	A	2: 36,245,210	N395K	probably benign	Het
Ptprq	A	T	10: 107,590,959	Y1572N	probably damaging	Het
Pyroxd1	A	T	6: 142,358,501	H326L	probably benign	Het
Rapgef5	A	G	12: 117,755,969	D778G	probably benign	Het
Rbm46	T	A	3: 82,864,210	E366V	probably damaging	Het
Rnd1	G	T	15: 98,670,669	H209Q	probably benign	Het
Rnf122	A	T	8: 31,118,500	D32V	possibly damaging	Het
Samd4b	G	A	7: 28,406,456	P446S	probably benign	Het
Slco1a5	C	A	6: 142,259,008	A187S	possibly damaging	Het
Smarca4	G	A	9: 21,686,247	V1436M	probably damaging	Het
Smok2a	G	A	17: 13,226,639	G368R	possibly damaging	Het
Smok3c	T	A	5: 138,064,495	H81Q	probably damaging	Het
Soga3	T	C	10: 29,197,003	S764P	possibly damaging	Het
Stk16	T	C	1: 75,213,652	V245A	probably damaging	Het
Svep1	A	T	4: 58,094,122	N1505K	possibly damaging	Het
Tigd4	G	A	3: 84,595,164	A463T	probably benign	Het
Tmem117	T	C	15: 94,714,918	F112L	probably benign	Het
Tmem72	A	G	6: 116,698,330	I67T	probably benign	Het
Tnik	A	G	3: 28,663,909		probably null	Het
Trav14-2	A	G	14: 53,641,058	Q66R	probably damaging	Het
Trpv6	T	A	6: 41,621,342	D677V	probably damaging	Het
Vgll4	C	T	6: 114,862,196	S278N	unknown	Het
Wdfy4	C	T	14: 33,070,618	W2157*	probably null	Het

Other mutations in Ntrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01928:Ntrk2	APN	13	58846851	missense	probably damaging	1.00
IGL02331:Ntrk2	APN	13	58846856	critical splice donor site	probably null
IGL02465:Ntrk2	APN	13	59060380	missense	probably damaging	1.00
Brainy	UTSW	13	59126568	missense	probably damaging	1.00
PIT4366001:Ntrk2	UTSW	13	59060335	missense	probably damaging	1.00
R0102:Ntrk2	UTSW	13	58808793	missense	probably benign	0.00
R0547:Ntrk2	UTSW	13	58874370	missense	probably damaging	0.99
R0615:Ntrk2	UTSW	13	59128186	nonsense	probably null
R0620:Ntrk2	UTSW	13	58846821	missense	probably benign
R1770:Ntrk2	UTSW	13	58861318	missense	possibly damaging	0.67
R2063:Ntrk2	UTSW	13	58859297	missense	probably damaging	1.00
R2089:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2091:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2091:Ntrk2	UTSW	13	58859301	missense	possibly damaging	0.95
R2178:Ntrk2	UTSW	13	58808802	missense	probably benign	0.06
R2275:Ntrk2	UTSW	13	58861351	missense	probably damaging	1.00
R2370:Ntrk2	UTSW	13	59054434	missense	probably benign	0.28
R2413:Ntrk2	UTSW	13	58874412	missense	possibly damaging	0.56
R2520:Ntrk2	UTSW	13	59054276	splice site	probably null
R2926:Ntrk2	UTSW	13	59060284	missense	probably damaging	1.00
R4163:Ntrk2	UTSW	13	58860240	missense	probably damaging	1.00
R4320:Ntrk2	UTSW	13	58860146	missense	possibly damaging	0.48
R4348:Ntrk2	UTSW	13	58878259	missense	probably damaging	1.00
R4440:Ntrk2	UTSW	13	59060312	missense	probably damaging	1.00
R4534:Ntrk2	UTSW	13	59126529	missense	probably damaging	1.00
R4695:Ntrk2	UTSW	13	59126493	missense	probably damaging	0.99
R5356:Ntrk2	UTSW	13	59060242	missense	probably damaging	1.00
R5471:Ntrk2	UTSW	13	58871760	missense	probably benign	0.01
R5750:Ntrk2	UTSW	13	58808922	missense	probably benign	0.02
R5916:Ntrk2	UTSW	13	58808729	start codon destroyed	probably null	0.98
R5972:Ntrk2	UTSW	13	58837819	missense	probably damaging	1.00
R6015:Ntrk2	UTSW	13	59060395	missense	probably damaging	1.00
R6298:Ntrk2	UTSW	13	58871756	nonsense	probably null
R6419:Ntrk2	UTSW	13	58861299	nonsense	probably null
R6488:Ntrk2	UTSW	13	58861356	missense	possibly damaging	0.93
R6611:Ntrk2	UTSW	13	59054414	missense	probably damaging	1.00
R6827:Ntrk2	UTSW	13	59126568	missense	probably damaging	1.00
R6911:Ntrk2	UTSW	13	58859215	missense	probably damaging	1.00
R7387:Ntrk2	UTSW	13	58985979	missense	probably damaging	1.00
R7561:Ntrk2	UTSW	13	58861388	missense	probably benign	0.31
R8031:Ntrk2	UTSW	13	58874379	missense	probably benign
R8044:Ntrk2	UTSW	13	59126499	missense	probably damaging	1.00
R8422:Ntrk2	UTSW	13	58985901	missense	probably damaging	1.00
R8941:Ntrk2	UTSW	13	59060295	missense	probably damaging	1.00
R8990:Ntrk2	UTSW	13	58860174	nonsense	probably null
R9129:Ntrk2	UTSW	13	59128270	missense	probably benign	0.01
Z1176:Ntrk2	UTSW	13	58874333	missense	probably benign
Z1177:Ntrk2	UTSW	13	58859273	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAAAGTGGGCGTGACTC -3'
(R):5'- TGATTTGCCAGAGACACCCAC -3'

Sequencing Primer
(F):5'- GCGTGACTCCCAAAGGTTG -3'
(R):5'- GGTAGTGATGTCCTTCCCAGAC -3'

Posted On

2019-10-07