Incidental Mutation 'R7445:Smok2a'
ID 577259
Institutional Source Beutler Lab
Gene Symbol Smok2a
Ensembl Gene ENSMUSG00000073458
Gene Name sperm motility kinase 2A
Synonyms Smok2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7445 (G1)
Quality Score 152.008
Status Validated
Chromosome 17
Chromosomal Location 13221188-13227658 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13226639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 368 (G368R)
Ref Sequence ENSEMBL: ENSMUSP00000094432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080647] [ENSMUST00000162940]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080647
AA Change: G368R

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094432
Gene: ENSMUSG00000073458
AA Change: G368R

DomainStartEndE-ValueType
S_TKc 28 276 2.02e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162940
SMART Domains Protein: ENSMUSP00000124967
Gene: ENSMUSG00000073457

DomainStartEndE-ValueType
S_TKc 8 256 3.13e-98 SMART
low complexity region 393 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Ms4a14 T G 19: 11,302,972 K741Q probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Smok2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Smok2a APN 17 13226490 missense probably benign 0.00
R5809:Smok2a UTSW 17 13226978 missense possibly damaging 0.93
R6046:Smok2a UTSW 17 13226134 missense probably benign 0.34
R6444:Smok2a UTSW 17 13225613 missense probably benign 0.01
R6464:Smok2a UTSW 17 13226430 missense probably damaging 1.00
R6896:Smok2a UTSW 17 13225871 missense probably benign 0.03
R6912:Smok2a UTSW 17 13225656 missense probably benign 0.08
R7027:Smok2a UTSW 17 13225779 missense probably damaging 1.00
R7793:Smok2a UTSW 17 13225626 missense possibly damaging 0.59
R7935:Smok2a UTSW 17 13225712 missense probably damaging 0.97
R8274:Smok2a UTSW 17 13226894 missense probably benign 0.01
R8293:Smok2a UTSW 17 13226904 missense probably benign 0.00
R8316:Smok2a UTSW 17 13226273 missense probably damaging 1.00
R8413:Smok2a UTSW 17 13225612 missense probably benign 0.20
R9067:Smok2a UTSW 17 13226938 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACCCTGCGATTGTAAAAGC -3'
(R):5'- GGGAACACTCCTAGTACAGGTG -3'

Sequencing Primer
(F):5'- TTGGGTTCCAAGCTCAAGAC -3'
(R):5'- ACTCCTAGTACAGGTGTGTGTTTG -3'
Posted On 2019-10-07