Incidental Mutation 'R7445:Ms4a14'
ID577263
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7445 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11302972 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 741 (K741Q)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect probably benign
Transcript: ENSMUST00000187467
AA Change: K741Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: K741Q

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,619 S233T probably damaging Het
1700034E13Rik T A 18: 52,660,481 C29S probably damaging Het
1700061G19Rik G A 17: 56,882,973 R333Q possibly damaging Het
9130409I23Rik A G 1: 181,055,012 N113S possibly damaging Het
Ank3 A G 10: 69,992,124 T2208A Het
Ap4s1 T C 12: 51,738,641 L132P probably damaging Het
Ascl4 C T 10: 85,928,500 R4C probably benign Het
Brd7 A T 8: 88,361,708 Y18N probably damaging Het
Cacna2d3 A G 14: 29,058,618 S648P possibly damaging Het
Camta1 C T 4: 151,144,291 E695K possibly damaging Het
Ccdc28b A G 4: 129,622,607 F53L probably benign Het
Chaf1a A G 17: 56,062,170 D467G possibly damaging Het
Cnnm1 G A 19: 43,440,821 R126H possibly damaging Het
Cog5 T G 12: 31,919,672 S730R possibly damaging Het
Col11a1 A T 3: 114,193,929 E1374D unknown Het
Csmd1 A G 8: 16,158,254 I1229T possibly damaging Het
Dnajc30 T C 5: 135,064,378 L43P probably damaging Het
Eif3f C T 7: 108,934,658 T76M unknown Het
Ermap G A 4: 119,188,710 T42I unknown Het
Gpd1l C T 9: 114,920,674 G25S probably damaging Het
Heatr1 G T 13: 12,431,038 W1632L possibly damaging Het
Ice1 T C 13: 70,596,167 D29G Het
Ipo8 T C 6: 148,789,817 D685G probably benign Het
Klra10 T C 6: 130,275,856 T152A probably benign Het
Lmntd1 T A 6: 145,429,967 S82C probably damaging Het
Maip1 T C 1: 57,407,031 S87P possibly damaging Het
Mapkapk2 A G 1: 131,097,519 S3P unknown Het
Mei4 A G 9: 81,890,239 Y35C possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncapg2 A G 12: 116,419,268 I240V possibly damaging Het
Ncbp1 T A 4: 46,149,914 M145K probably damaging Het
Nmur2 A G 11: 56,032,940 F263L probably damaging Het
Ntrk2 A G 13: 58,846,762 E164G probably benign Het
Olfr48 T A 2: 89,844,272 T234S probably damaging Het
Olfr705 A G 7: 106,873,342 L301S possibly damaging Het
Olfr785 A T 10: 129,409,885 D173V probably benign Het
P3h2 T A 16: 25,985,065 Y317F probably damaging Het
Pcmtd1 C T 1: 7,120,420 R38C probably damaging Het
Pcyox1 T C 6: 86,391,679 T286A possibly damaging Het
Pdxk T C 10: 78,447,967 D131G probably benign Het
Ppl T C 16: 5,089,068 D1121G probably damaging Het
Prkra T C 2: 76,633,598 D240G probably benign Het
Ptgs1 C A 2: 36,245,210 N395K probably benign Het
Ptprq A T 10: 107,590,959 Y1572N probably damaging Het
Pyroxd1 A T 6: 142,358,501 H326L probably benign Het
Rapgef5 A G 12: 117,755,969 D778G probably benign Het
Rbm46 T A 3: 82,864,210 E366V probably damaging Het
Rnd1 G T 15: 98,670,669 H209Q probably benign Het
Rnf122 A T 8: 31,118,500 D32V possibly damaging Het
Samd4b G A 7: 28,406,456 P446S probably benign Het
Slco1a5 C A 6: 142,259,008 A187S possibly damaging Het
Smarca4 G A 9: 21,686,247 V1436M probably damaging Het
Smok2a G A 17: 13,226,639 G368R possibly damaging Het
Smok3c T A 5: 138,064,495 H81Q probably damaging Het
Soga3 T C 10: 29,197,003 S764P possibly damaging Het
Stk16 T C 1: 75,213,652 V245A probably damaging Het
Svep1 A T 4: 58,094,122 N1505K possibly damaging Het
Tigd4 G A 3: 84,595,164 A463T probably benign Het
Tmem117 T C 15: 94,714,918 F112L probably benign Het
Tmem72 A G 6: 116,698,330 I67T probably benign Het
Tnik A G 3: 28,663,909 probably null Het
Trav14-2 A G 14: 53,641,058 Q66R probably damaging Het
Trpv6 T A 6: 41,621,342 D677V probably damaging Het
Vgll4 C T 6: 114,862,196 S278N unknown Het
Wdfy4 C T 14: 33,070,618 W2157* probably null Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7532:Ms4a14 UTSW 19 11303959 missense possibly damaging 0.86
R7689:Ms4a14 UTSW 19 11302542 missense probably benign 0.33
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATGACTTCTGTTCGAATGTCCC -3'
(R):5'- TCCATCTGAAGGGACTCCATC -3'

Sequencing Primer
(F):5'- ACTTCTGGATATTGCTGGATTTGAAC -3'
(R):5'- TCTGAAGGGACTCCATCTCAAGAG -3'
Posted On2019-10-07