Incidental Mutation 'R7446:Ttc17'
ID 577274
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Name tetratricopeptide repeat domain 17
Synonyms D2Bwg1005e, 9130020K17Rik
MMRRC Submission 045522-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.556) question?
Stock # R7446 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 94131112-94237034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94205495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 284 (V284M)
Ref Sequence ENSEMBL: ENSMUSP00000106869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
AlphaFold E9PVB5
Predicted Effect possibly damaging
Transcript: ENSMUST00000094801
AA Change: V284M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: V284M

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111237
AA Change: V284M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: V284M

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111238
AA Change: V284M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: V284M

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,950,441 (GRCm39) D1446G probably benign Het
Adgrg1 A G 8: 95,738,412 (GRCm39) Y635C probably damaging Het
Akr1cl G A 1: 65,055,837 (GRCm39) R222W probably damaging Het
C2 G A 17: 35,094,986 (GRCm39) R250C probably damaging Het
Cdk15 A G 1: 59,328,854 (GRCm39) Y254C probably damaging Het
Celsr1 T C 15: 85,791,874 (GRCm39) T2576A possibly damaging Het
Cfap61 C T 2: 145,995,758 (GRCm39) R1108C probably benign Het
Clca3a1 A G 3: 144,733,188 (GRCm39) S107P possibly damaging Het
Cplane1 A G 15: 8,261,564 (GRCm39) D2460G probably damaging Het
Cpsf1 A G 15: 76,485,950 (GRCm39) S407P probably benign Het
Crisp4 T C 1: 18,192,962 (GRCm39) T252A probably damaging Het
Ctbs A G 3: 146,164,573 (GRCm39) Y242C probably damaging Het
Cul4a A G 8: 13,186,874 (GRCm39) T537A probably benign Het
D930020B18Rik T C 10: 121,503,650 (GRCm39) I275T possibly damaging Het
Dcaf7 T C 11: 105,944,561 (GRCm39) V248A probably benign Het
Def8 T C 8: 124,181,061 (GRCm39) C153R probably damaging Het
Dennd1a A T 2: 37,706,991 (GRCm39) V505D possibly damaging Het
Dpysl5 A C 5: 30,936,231 (GRCm39) D207A probably benign Het
Dync2h1 A T 9: 7,041,720 (GRCm39) S3307R probably benign Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Erf A T 7: 24,945,556 (GRCm39) C72S probably damaging Het
Fastkd3 A T 13: 68,740,079 (GRCm39) H47L unknown Het
Gm5591 C T 7: 38,218,933 (GRCm39) E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 66,992,736 (GRCm39) probably benign Het
Guk1 T C 11: 59,076,850 (GRCm39) T78A probably benign Het
Hephl1 T C 9: 15,009,347 (GRCm39) T82A probably damaging Het
Htra4 A G 8: 25,527,181 (GRCm39) S205P probably benign Het
Jakmip2 T C 18: 43,710,390 (GRCm39) D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,137,610 (GRCm39) probably null Het
Lrp1b T A 2: 41,561,069 (GRCm39) E286V Het
Lrp2 C A 2: 69,262,557 (GRCm39) G4415W probably damaging Het
Lrp2 C T 2: 69,290,018 (GRCm39) R3607H probably damaging Het
Mcph1 A G 8: 18,721,109 (GRCm39) K646E probably benign Het
Mgam T C 6: 40,723,266 (GRCm39) L457P probably damaging Het
Mink1 T A 11: 70,500,455 (GRCm39) S802T probably benign Het
Mrgprb5 C T 7: 47,818,252 (GRCm39) G161E possibly damaging Het
Mroh1 G A 15: 76,336,472 (GRCm39) G1565D possibly damaging Het
Mynn A G 3: 30,661,201 (GRCm39) K51R probably benign Het
Myo1b A G 1: 51,803,065 (GRCm39) F872S possibly damaging Het
Nbas A T 12: 13,443,499 (GRCm39) T1185S probably benign Het
Oas1d A T 5: 121,058,054 (GRCm39) I333L probably benign Het
Or10ak9 A T 4: 118,726,019 (GRCm39) I14F possibly damaging Het
Or4d10 A G 19: 12,051,061 (GRCm39) *312Q probably null Het
P2ry12 A G 3: 59,124,632 (GRCm39) *348Q probably null Het
Pik3cb A T 9: 98,928,711 (GRCm39) V848E probably damaging Het
Plcz1 A C 6: 139,959,312 (GRCm39) S282A possibly damaging Het
Prss46 A G 9: 110,679,189 (GRCm39) D130G probably damaging Het
Pygl T C 12: 70,243,784 (GRCm39) I644V probably benign Het
Ralgds T A 2: 28,435,901 (GRCm39) S509T probably damaging Het
Rdh16f2 A G 10: 127,712,767 (GRCm39) D255G probably benign Het
Scaf4 T C 16: 90,055,658 (GRCm39) D133G unknown Het
Sdk1 G A 5: 142,130,731 (GRCm39) S1630N probably damaging Het
Sema5b C T 16: 35,467,573 (GRCm39) T279I probably damaging Het
Slc24a3 T A 2: 145,422,902 (GRCm39) L207H probably damaging Het
Speer2 A T 16: 69,654,965 (GRCm39) S167T possibly damaging Het
Spock1 A G 13: 57,583,898 (GRCm39) I339T unknown Het
Srsf6 T A 2: 162,776,636 (GRCm39) S327T unknown Het
Syne1 T A 10: 5,172,266 (GRCm39) E5058D probably benign Het
Tcf19 A G 17: 35,825,428 (GRCm39) V243A probably benign Het
Tspan15 T C 10: 62,029,734 (GRCm39) D122G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Uspl1 T A 5: 149,141,082 (GRCm39) C360* probably null Het
Vmn1r181 A C 7: 23,684,356 (GRCm39) S274R probably benign Het
Xrcc5 T C 1: 72,433,132 (GRCm39) probably null Het
Zfp277 C T 12: 40,378,729 (GRCm39) R376H probably damaging Het
Zfp629 T C 7: 127,210,201 (GRCm39) E536G probably benign Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94,153,428 (GRCm39) splice site probably benign
IGL00870:Ttc17 APN 2 94,202,078 (GRCm39) splice site probably null
IGL01120:Ttc17 APN 2 94,202,141 (GRCm39) missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94,163,177 (GRCm39) nonsense probably null
IGL01895:Ttc17 APN 2 94,205,491 (GRCm39) missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94,161,012 (GRCm39) missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94,208,055 (GRCm39) missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94,173,006 (GRCm39) missense probably benign
IGL02456:Ttc17 APN 2 94,193,130 (GRCm39) splice site probably benign
IGL02475:Ttc17 APN 2 94,194,721 (GRCm39) missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94,205,566 (GRCm39) missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94,216,450 (GRCm39) missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0443:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0511:Ttc17 UTSW 2 94,153,465 (GRCm39) missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94,163,148 (GRCm39) missense probably benign 0.08
R1980:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R1981:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R1987:Ttc17 UTSW 2 94,194,690 (GRCm39) missense probably benign
R2064:Ttc17 UTSW 2 94,196,892 (GRCm39) missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94,132,139 (GRCm39) missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94,196,987 (GRCm39) missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94,206,419 (GRCm39) nonsense probably null
R3719:Ttc17 UTSW 2 94,194,672 (GRCm39) missense probably benign 0.27
R3852:Ttc17 UTSW 2 94,199,758 (GRCm39) missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94,206,491 (GRCm39) splice site probably benign
R4411:Ttc17 UTSW 2 94,173,098 (GRCm39) missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94,196,916 (GRCm39) missense probably benign 0.02
R4660:Ttc17 UTSW 2 94,194,774 (GRCm39) missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94,202,113 (GRCm39) missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94,163,236 (GRCm39) missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94,194,955 (GRCm39) missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94,196,980 (GRCm39) missense probably benign 0.01
R4870:Ttc17 UTSW 2 94,196,954 (GRCm39) missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94,133,905 (GRCm39) missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94,208,027 (GRCm39) missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94,192,866 (GRCm39) missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94,209,193 (GRCm39) missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94,189,100 (GRCm39) missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94,133,891 (GRCm39) missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94,216,447 (GRCm39) missense probably benign 0.02
R7204:Ttc17 UTSW 2 94,192,773 (GRCm39) missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94,205,479 (GRCm39) missense probably damaging 1.00
R7680:Ttc17 UTSW 2 94,196,889 (GRCm39) missense probably benign 0.06
R7912:Ttc17 UTSW 2 94,209,166 (GRCm39) missense probably damaging 1.00
R8083:Ttc17 UTSW 2 94,204,909 (GRCm39) missense probably damaging 1.00
R8304:Ttc17 UTSW 2 94,199,526 (GRCm39) intron probably benign
R8381:Ttc17 UTSW 2 94,132,166 (GRCm39) missense probably damaging 1.00
R8512:Ttc17 UTSW 2 94,202,108 (GRCm39) missense probably damaging 1.00
R8737:Ttc17 UTSW 2 94,206,374 (GRCm39) critical splice donor site probably null
R8850:Ttc17 UTSW 2 94,237,003 (GRCm39) missense possibly damaging 0.55
R8886:Ttc17 UTSW 2 94,205,473 (GRCm39) missense probably benign 0.19
R8888:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R8891:Ttc17 UTSW 2 94,192,764 (GRCm39) missense probably damaging 1.00
R9336:Ttc17 UTSW 2 94,189,198 (GRCm39) missense probably benign 0.00
R9600:Ttc17 UTSW 2 94,204,890 (GRCm39) missense probably damaging 1.00
R9632:Ttc17 UTSW 2 94,209,097 (GRCm39) missense probably damaging 1.00
R9642:Ttc17 UTSW 2 94,194,735 (GRCm39) missense probably benign 0.00
R9657:Ttc17 UTSW 2 94,237,010 (GRCm39) start codon destroyed probably benign 0.02
X0013:Ttc17 UTSW 2 94,161,015 (GRCm39) missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94,154,861 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTCTGTTCAAAAGCTCAGAGTG -3'
(R):5'- TGGCAACACTTGTAACTGTGAAG -3'

Sequencing Primer
(F):5'- GTTCAAAAGCTCAGAGTGTTATGAC -3'
(R):5'- CAACACTTGTAACTGTGAAGTTGAGG -3'
Posted On 2019-10-07