Incidental Mutation 'R7446:Srsf6'
ID 577277
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Name serine and arginine-rich splicing factor 6
Synonyms 1210001E11Rik, Sfrs6
MMRRC Submission 045522-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.778) question?
Stock # R7446 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 162773448-162779041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 162776636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 327 (S327T)
Ref Sequence ENSEMBL: ENSMUSP00000119065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
AlphaFold Q3TWW8
Predicted Effect probably benign
Transcript: ENSMUST00000017065
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126163
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130411
AA Change: S327T
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: S327T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,950,441 (GRCm39) D1446G probably benign Het
Adgrg1 A G 8: 95,738,412 (GRCm39) Y635C probably damaging Het
Akr1cl G A 1: 65,055,837 (GRCm39) R222W probably damaging Het
C2 G A 17: 35,094,986 (GRCm39) R250C probably damaging Het
Cdk15 A G 1: 59,328,854 (GRCm39) Y254C probably damaging Het
Celsr1 T C 15: 85,791,874 (GRCm39) T2576A possibly damaging Het
Cfap61 C T 2: 145,995,758 (GRCm39) R1108C probably benign Het
Clca3a1 A G 3: 144,733,188 (GRCm39) S107P possibly damaging Het
Cplane1 A G 15: 8,261,564 (GRCm39) D2460G probably damaging Het
Cpsf1 A G 15: 76,485,950 (GRCm39) S407P probably benign Het
Crisp4 T C 1: 18,192,962 (GRCm39) T252A probably damaging Het
Ctbs A G 3: 146,164,573 (GRCm39) Y242C probably damaging Het
Cul4a A G 8: 13,186,874 (GRCm39) T537A probably benign Het
D930020B18Rik T C 10: 121,503,650 (GRCm39) I275T possibly damaging Het
Dcaf7 T C 11: 105,944,561 (GRCm39) V248A probably benign Het
Def8 T C 8: 124,181,061 (GRCm39) C153R probably damaging Het
Dennd1a A T 2: 37,706,991 (GRCm39) V505D possibly damaging Het
Dpysl5 A C 5: 30,936,231 (GRCm39) D207A probably benign Het
Dync2h1 A T 9: 7,041,720 (GRCm39) S3307R probably benign Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Erf A T 7: 24,945,556 (GRCm39) C72S probably damaging Het
Fastkd3 A T 13: 68,740,079 (GRCm39) H47L unknown Het
Gm5591 C T 7: 38,218,933 (GRCm39) E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 66,992,736 (GRCm39) probably benign Het
Guk1 T C 11: 59,076,850 (GRCm39) T78A probably benign Het
Hephl1 T C 9: 15,009,347 (GRCm39) T82A probably damaging Het
Htra4 A G 8: 25,527,181 (GRCm39) S205P probably benign Het
Jakmip2 T C 18: 43,710,390 (GRCm39) D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,137,610 (GRCm39) probably null Het
Lrp1b T A 2: 41,561,069 (GRCm39) E286V Het
Lrp2 C A 2: 69,262,557 (GRCm39) G4415W probably damaging Het
Lrp2 C T 2: 69,290,018 (GRCm39) R3607H probably damaging Het
Mcph1 A G 8: 18,721,109 (GRCm39) K646E probably benign Het
Mgam T C 6: 40,723,266 (GRCm39) L457P probably damaging Het
Mink1 T A 11: 70,500,455 (GRCm39) S802T probably benign Het
Mrgprb5 C T 7: 47,818,252 (GRCm39) G161E possibly damaging Het
Mroh1 G A 15: 76,336,472 (GRCm39) G1565D possibly damaging Het
Mynn A G 3: 30,661,201 (GRCm39) K51R probably benign Het
Myo1b A G 1: 51,803,065 (GRCm39) F872S possibly damaging Het
Nbas A T 12: 13,443,499 (GRCm39) T1185S probably benign Het
Oas1d A T 5: 121,058,054 (GRCm39) I333L probably benign Het
Or10ak9 A T 4: 118,726,019 (GRCm39) I14F possibly damaging Het
Or4d10 A G 19: 12,051,061 (GRCm39) *312Q probably null Het
P2ry12 A G 3: 59,124,632 (GRCm39) *348Q probably null Het
Pik3cb A T 9: 98,928,711 (GRCm39) V848E probably damaging Het
Plcz1 A C 6: 139,959,312 (GRCm39) S282A possibly damaging Het
Prss46 A G 9: 110,679,189 (GRCm39) D130G probably damaging Het
Pygl T C 12: 70,243,784 (GRCm39) I644V probably benign Het
Ralgds T A 2: 28,435,901 (GRCm39) S509T probably damaging Het
Rdh16f2 A G 10: 127,712,767 (GRCm39) D255G probably benign Het
Scaf4 T C 16: 90,055,658 (GRCm39) D133G unknown Het
Sdk1 G A 5: 142,130,731 (GRCm39) S1630N probably damaging Het
Sema5b C T 16: 35,467,573 (GRCm39) T279I probably damaging Het
Slc24a3 T A 2: 145,422,902 (GRCm39) L207H probably damaging Het
Speer2 A T 16: 69,654,965 (GRCm39) S167T possibly damaging Het
Spock1 A G 13: 57,583,898 (GRCm39) I339T unknown Het
Syne1 T A 10: 5,172,266 (GRCm39) E5058D probably benign Het
Tcf19 A G 17: 35,825,428 (GRCm39) V243A probably benign Het
Tspan15 T C 10: 62,029,734 (GRCm39) D122G probably benign Het
Ttc17 C T 2: 94,205,495 (GRCm39) V284M probably damaging Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Uspl1 T A 5: 149,141,082 (GRCm39) C360* probably null Het
Vmn1r181 A C 7: 23,684,356 (GRCm39) S274R probably benign Het
Xrcc5 T C 1: 72,433,132 (GRCm39) probably null Het
Zfp277 C T 12: 40,378,729 (GRCm39) R376H probably damaging Het
Zfp629 T C 7: 127,210,201 (GRCm39) E536G probably benign Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162,773,627 (GRCm39) missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162,775,674 (GRCm39) missense probably damaging 1.00
R1292:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1789:Srsf6 UTSW 2 162,776,408 (GRCm39) unclassified probably benign
R1936:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1937:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1939:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1940:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R2225:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162,776,211 (GRCm39) unclassified probably benign
R4290:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4292:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4293:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4294:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4295:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4592:Srsf6 UTSW 2 162,773,643 (GRCm39) missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162,775,629 (GRCm39) missense probably benign 0.45
R4657:Srsf6 UTSW 2 162,775,347 (GRCm39) missense probably benign 0.01
R7378:Srsf6 UTSW 2 162,776,489 (GRCm39) missense unknown
R7578:Srsf6 UTSW 2 162,774,782 (GRCm39) missense probably benign 0.00
R7730:Srsf6 UTSW 2 162,773,643 (GRCm39) missense probably damaging 0.99
R7908:Srsf6 UTSW 2 162,775,760 (GRCm39) missense unknown
R9498:Srsf6 UTSW 2 162,774,009 (GRCm39) missense probably benign 0.07
X0020:Srsf6 UTSW 2 162,775,418 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAGTCACGTAGTAGGTCAC -3'
(R):5'- GAGGGCTTCATACCACCATTTTAG -3'

Sequencing Primer
(F):5'- TCACGTAGTAGGTCACGGTCTC -3'
(R):5'- TTTGGCCACAAATCAAATTCCGG -3'
Posted On 2019-10-07