Incidental Mutation 'R7446:Clca1'
ID577279
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Namechloride channel accessory 1
Synonymsgob-5, gob5, Clca3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145003817-145032776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145027427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 107 (S107P)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029919
AA Change: S107P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: S107P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2178:Clca1 UTSW 3 145006102 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5044:Clca1 UTSW 3 145007928 splice site probably null
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6729:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7106:Clca1 UTSW 3 145027429 missense probably damaging 0.98
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7212:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Z1176:Clca1 UTSW 3 145013921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTACTGCAATTGCCTGGCAC -3'
(R):5'- TTGGTCAATTGCTCAGTTGC -3'

Sequencing Primer
(F):5'- ACTGCAATTGCCTGGCACTATAG -3'
(R):5'- CAATTGCTCAGTTGCTTGGTTGTTC -3'
Posted On2019-10-07