Mutagenetix > Incidental Mutations

Incidental Mutation 'R7446:Mgam'

577286

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R7446 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40746332 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 457 (L457P)

Ref Sequence

ENSEMBL: ENSMUSP00000144627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

Predicted Effect

probably benign
Transcript: ENSMUST00000071535

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201148

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: L457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: L457P

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202966
AA Change: L338P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: L338P

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.2870

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,232,080	D2460G	probably damaging	Het
4930407I10Rik	A	G	15: 82,066,240	D1446G	probably benign	Het
Adgrg1	A	G	8: 95,011,784	Y635C	probably damaging	Het
Akr1cl	G	A	1: 65,016,678	R222W	probably damaging	Het
C2	G	A	17: 34,876,010	R250C	probably damaging	Het
Cdk15	A	G	1: 59,289,695	Y254C	probably damaging	Het
Celsr1	T	C	15: 85,907,673	T2576A	possibly damaging	Het
Cfap61	C	T	2: 146,153,838	R1108C	probably benign	Het
Clca1	A	G	3: 145,027,427	S107P	possibly damaging	Het
Cpsf1	A	G	15: 76,601,750	S407P	probably benign	Het
Crisp4	T	C	1: 18,122,738	T252A	probably damaging	Het
Ctbs	A	G	3: 146,458,818	Y242C	probably damaging	Het
Cul4a	A	G	8: 13,136,874	T537A	probably benign	Het
D930020B18Rik	T	C	10: 121,667,745	I275T	possibly damaging	Het
Dcaf7	T	C	11: 106,053,735	V248A	probably benign	Het
Def8	T	C	8: 123,454,322	C153R	probably damaging	Het
Dennd1a	A	T	2: 37,816,979	V505D	possibly damaging	Het
Dpysl5	A	C	5: 30,778,887	D207A	probably benign	Het
Dync2h1	A	T	9: 7,041,720	S3307R	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Erf	A	T	7: 25,246,131	C72S	probably damaging	Het
Fastkd3	A	T	13: 68,591,960	H47L	unknown	Het
Gm5591	C	T	7: 38,519,509	E647K	probably benign	Het
Gng12	TGTCCAGCAAG	TG	6: 67,015,752		probably benign	Het
Guk1	T	C	11: 59,186,024	T78A	probably benign	Het
Hephl1	T	C	9: 15,098,051	T82A	probably damaging	Het
Htra4	A	G	8: 25,037,165	S205P	probably benign	Het
Jakmip2	T	C	18: 43,577,325	D271G	probably damaging	Het
Krt16	CAGTATCTG	C	11: 100,246,784		probably null	Het
Lrp1b	T	A	2: 41,671,057	E286V		Het
Lrp2	C	A	2: 69,432,213	G4415W	probably damaging	Het
Lrp2	C	T	2: 69,459,674	R3607H	probably damaging	Het
Mcph1	A	G	8: 18,671,093	K646E	probably benign	Het
Mink1	T	A	11: 70,609,629	S802T	probably benign	Het
Mrgprb5	C	T	7: 48,168,504	G161E	possibly damaging	Het
Mroh1	G	A	15: 76,452,272	G1565D	possibly damaging	Het
Mynn	A	G	3: 30,607,052	K51R	probably benign	Het
Myo1b	A	G	1: 51,763,906	F872S	possibly damaging	Het
Nbas	A	T	12: 13,393,498	T1185S	probably benign	Het
Oas1d	A	T	5: 120,919,991	I333L	probably benign	Het
Olfr1331	A	T	4: 118,868,822	I14F	possibly damaging	Het
Olfr1425	A	G	19: 12,073,697	*312Q	probably null	Het
P2ry12	A	G	3: 59,217,211	*348Q	probably null	Het
Pik3cb	A	T	9: 99,046,658	V848E	probably damaging	Het
Plcz1	A	C	6: 140,013,586	S282A	possibly damaging	Het
Prss46	A	G	9: 110,850,121	D130G	probably damaging	Het
Pygl	T	C	12: 70,197,010	I644V	probably benign	Het
Ralgds	T	A	2: 28,545,889	S509T	probably damaging	Het
Rdh16f2	A	G	10: 127,876,898	D255G	probably benign	Het
Scaf4	T	C	16: 90,258,770	D133G	unknown	Het
Sdk1	G	A	5: 142,144,976	S1630N	probably damaging	Het
Sema5b	C	T	16: 35,647,203	T279I	probably damaging	Het
Slc24a3	T	A	2: 145,580,982	L207H	probably damaging	Het
Speer2	A	T	16: 69,858,077	S167T	possibly damaging	Het
Spock1	A	G	13: 57,436,085	I339T	unknown	Het
Srsf6	T	A	2: 162,934,716	S327T	unknown	Het
Syne1	T	A	10: 5,222,266	E5058D	probably benign	Het
Tcf19	A	G	17: 35,514,531	V243A	probably benign	Het
Tspan15	T	C	10: 62,193,955	D122G	probably benign	Het
Ttc17	C	T	2: 94,375,150	V284M	probably damaging	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Uspl1	T	A	5: 149,204,272	C360*	probably null	Het
Vmn1r181	A	C	7: 23,984,931	S274R	probably benign	Het
Xrcc5	T	C	1: 72,393,973		probably null	Het
Zfp277	C	T	12: 40,328,730	R376H	probably damaging	Het
Zfp629	T	C	7: 127,611,029	E536G	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCTTGCTGTGCAGAGGA -3'
(R):5'- TCTGTAAGGAAGAAGCACAAGAC -3'

Sequencing Primer
(F):5'- CTTGCTGTGCAGAGGATACTTG -3'
(R):5'- GGGACAGAACACAGACCACAG -3'

Posted On

2019-10-07