Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Kif21b'

57729

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0629 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 136172157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000075164] [ENSMUST00000075164] [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000075164

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130864

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130864

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165333

Meta Mutation Damage Score

0.9480

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGTGTGTGAGGAATGCAGGTAG -3'
(R):5'- TGGTCCAGGTCCCACTTCTTGATG -3'

Sequencing Primer
(F):5'- CACAGGACCCAGTGATTTAGTTTG -3'
(R):5'- TCTTGATGCCATTGTCTCTGG -3'

Posted On

2013-07-11