Incidental Mutation 'R7446:Pik3cb'
ID577302
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99046658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 848 (V848E)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035037
AA Change: V848E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: V848E

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7679:Pik3cb UTSW 9 99088607 missense probably benign 0.05
R7831:Pik3cb UTSW 9 99088613 missense probably benign
R8300:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAATGCAGACGCTCTC -3'
(R):5'- GTCCAAGTTCCATTTTCCGTATGG -3'

Sequencing Primer
(F):5'- TCTGAGCAGGCAGGGCTTC -3'
(R):5'- CCGTATGGTATTACTGACTGACAAGC -3'
Posted On2019-10-07