Incidental Mutation 'R7446:Mink1'
ID577309
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70609629 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 802 (S802T)
Ref Sequence ENSEMBL: ENSMUSP00000099619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072237
AA Change: S839T

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: S839T

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072873
AA Change: S831T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: S831T

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
AA Change: S828T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: S828T

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102558
AA Change: S794T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: S794T

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
AA Change: S802T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: S802T

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136663
AA Change: S692T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: S692T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
R7896:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R7979:Mink1 UTSW 11 70612282 missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70603768 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATAAGCGAGCAATTGGC -3'
(R):5'- GTCCCACAGTGACAGAGTAGTG -3'

Sequencing Primer
(F):5'- TGCTGGGAAGCCCTCTGTTC -3'
(R):5'- GTGAAAGAAGCTACTAACTCTGTTC -3'
Posted On2019-10-07