Incidental Mutation 'R7446:Sema5b'
ID577322
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35647203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 279 (T279I)
Ref Sequence ENSEMBL: ENSMUSP00000112536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect probably damaging
Transcript: ENSMUST00000050625
AA Change: T279I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: T279I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120756
AA Change: T279I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: T279I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R5993:Sema5b UTSW 16 35646202 missense probably damaging 1.00
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7066:Sema5b UTSW 16 35651312 missense probably benign 0.26
R7244:Sema5b UTSW 16 35660545 missense probably benign
R7497:Sema5b UTSW 16 35661330 missense probably damaging 1.00
R7516:Sema5b UTSW 16 35651170 missense probably benign 0.05
R7878:Sema5b UTSW 16 35661626 missense probably benign 0.00
R7961:Sema5b UTSW 16 35661626 missense probably benign 0.00
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35628018 missense probably benign 0.01
Z1176:Sema5b UTSW 16 35646273 missense probably benign 0.05
Z1176:Sema5b UTSW 16 35649864 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGTCGAGTCCTTCCTAGTGG -3'
(R):5'- CTGAGAAAGGATCTGCTGAGC -3'

Sequencing Primer
(F):5'- GTCCTTCCTAGTGGGCCGTC -3'
(R):5'- ATCTGCTGAGCCCACTAGG -3'
Posted On2019-10-07