Incidental Mutation 'R7446:Speer2'
ID577323
Institutional Source Beutler Lab
Gene Symbol Speer2
Ensembl Gene ENSMUSG00000063163
Gene Namespermatogenesis associated glutamate (E)-rich protein 2
SynonymsSPEER-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location69856874-69863744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69858077 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 167 (S167T)
Ref Sequence ENSEMBL: ENSMUSP00000075821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000166256]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076500
AA Change: S167T

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: S167T

DomainStartEndE-ValueType
Pfam:Takusan 51 137 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166256
SMART Domains Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 1 49 2.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Speer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Speer2 APN 16 69860518 missense probably benign 0.01
IGL01115:Speer2 APN 16 69861651 nonsense probably null
IGL01694:Speer2 APN 16 69858112 missense probably damaging 0.98
IGL01694:Speer2 APN 16 69858113 missense probably damaging 1.00
IGL02738:Speer2 APN 16 69861712 missense probably benign
IGL03024:Speer2 APN 16 69858115 missense possibly damaging 0.95
IGL03062:Speer2 APN 16 69857977 missense probably damaging 0.96
R0054:Speer2 UTSW 16 69858752 missense probably damaging 0.99
R1248:Speer2 UTSW 16 69857067 unclassified probably null
R1952:Speer2 UTSW 16 69857164 missense probably damaging 0.96
R1993:Speer2 UTSW 16 69858077 missense probably benign 0.01
R1995:Speer2 UTSW 16 69858077 missense probably benign 0.01
R2063:Speer2 UTSW 16 69860497 missense probably benign 0.02
R2155:Speer2 UTSW 16 69860597 missense possibly damaging 0.63
R2216:Speer2 UTSW 16 69858842 missense possibly damaging 0.94
R4547:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4548:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4625:Speer2 UTSW 16 69858754 nonsense probably null
R4692:Speer2 UTSW 16 69857972 missense possibly damaging 0.91
R4841:Speer2 UTSW 16 69858100 missense probably benign 0.26
R4842:Speer2 UTSW 16 69858100 missense probably benign 0.26
R5035:Speer2 UTSW 16 69857941 critical splice donor site probably null
R5133:Speer2 UTSW 16 69858820 missense probably null 0.06
R5812:Speer2 UTSW 16 69858895 missense possibly damaging 0.82
R6348:Speer2 UTSW 16 69858007 missense possibly damaging 0.83
R6854:Speer2 UTSW 16 69858887 missense probably damaging 0.96
R8068:Speer2 UTSW 16 69860524 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGTGTCAGACAGTATTAGCTTGAC -3'
(R):5'- GGGCTGCAGCAATAATTTCTTC -3'

Sequencing Primer
(F):5'- CAGACAGTATTAGCTTGACTGAGTTG -3'
(R):5'- CCCTGAAATGGCTGTTTGC -3'
Posted On2019-10-07