Incidental Mutation 'R7446:Enpp5'
ID 577327
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms D17Abb1e
MMRRC Submission 045522-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7446 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 44389704-44397458 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44396155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
AlphaFold Q9EQG7
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,950,441 (GRCm39) D1446G probably benign Het
Adgrg1 A G 8: 95,738,412 (GRCm39) Y635C probably damaging Het
Akr1cl G A 1: 65,055,837 (GRCm39) R222W probably damaging Het
C2 G A 17: 35,094,986 (GRCm39) R250C probably damaging Het
Cdk15 A G 1: 59,328,854 (GRCm39) Y254C probably damaging Het
Celsr1 T C 15: 85,791,874 (GRCm39) T2576A possibly damaging Het
Cfap61 C T 2: 145,995,758 (GRCm39) R1108C probably benign Het
Clca3a1 A G 3: 144,733,188 (GRCm39) S107P possibly damaging Het
Cplane1 A G 15: 8,261,564 (GRCm39) D2460G probably damaging Het
Cpsf1 A G 15: 76,485,950 (GRCm39) S407P probably benign Het
Crisp4 T C 1: 18,192,962 (GRCm39) T252A probably damaging Het
Ctbs A G 3: 146,164,573 (GRCm39) Y242C probably damaging Het
Cul4a A G 8: 13,186,874 (GRCm39) T537A probably benign Het
D930020B18Rik T C 10: 121,503,650 (GRCm39) I275T possibly damaging Het
Dcaf7 T C 11: 105,944,561 (GRCm39) V248A probably benign Het
Def8 T C 8: 124,181,061 (GRCm39) C153R probably damaging Het
Dennd1a A T 2: 37,706,991 (GRCm39) V505D possibly damaging Het
Dpysl5 A C 5: 30,936,231 (GRCm39) D207A probably benign Het
Dync2h1 A T 9: 7,041,720 (GRCm39) S3307R probably benign Het
Erf A T 7: 24,945,556 (GRCm39) C72S probably damaging Het
Fastkd3 A T 13: 68,740,079 (GRCm39) H47L unknown Het
Gm5591 C T 7: 38,218,933 (GRCm39) E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 66,992,736 (GRCm39) probably benign Het
Guk1 T C 11: 59,076,850 (GRCm39) T78A probably benign Het
Hephl1 T C 9: 15,009,347 (GRCm39) T82A probably damaging Het
Htra4 A G 8: 25,527,181 (GRCm39) S205P probably benign Het
Jakmip2 T C 18: 43,710,390 (GRCm39) D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,137,610 (GRCm39) probably null Het
Lrp1b T A 2: 41,561,069 (GRCm39) E286V Het
Lrp2 C A 2: 69,262,557 (GRCm39) G4415W probably damaging Het
Lrp2 C T 2: 69,290,018 (GRCm39) R3607H probably damaging Het
Mcph1 A G 8: 18,721,109 (GRCm39) K646E probably benign Het
Mgam T C 6: 40,723,266 (GRCm39) L457P probably damaging Het
Mink1 T A 11: 70,500,455 (GRCm39) S802T probably benign Het
Mrgprb5 C T 7: 47,818,252 (GRCm39) G161E possibly damaging Het
Mroh1 G A 15: 76,336,472 (GRCm39) G1565D possibly damaging Het
Mynn A G 3: 30,661,201 (GRCm39) K51R probably benign Het
Myo1b A G 1: 51,803,065 (GRCm39) F872S possibly damaging Het
Nbas A T 12: 13,443,499 (GRCm39) T1185S probably benign Het
Oas1d A T 5: 121,058,054 (GRCm39) I333L probably benign Het
Or10ak9 A T 4: 118,726,019 (GRCm39) I14F possibly damaging Het
Or4d10 A G 19: 12,051,061 (GRCm39) *312Q probably null Het
P2ry12 A G 3: 59,124,632 (GRCm39) *348Q probably null Het
Pik3cb A T 9: 98,928,711 (GRCm39) V848E probably damaging Het
Plcz1 A C 6: 139,959,312 (GRCm39) S282A possibly damaging Het
Prss46 A G 9: 110,679,189 (GRCm39) D130G probably damaging Het
Pygl T C 12: 70,243,784 (GRCm39) I644V probably benign Het
Ralgds T A 2: 28,435,901 (GRCm39) S509T probably damaging Het
Rdh16f2 A G 10: 127,712,767 (GRCm39) D255G probably benign Het
Scaf4 T C 16: 90,055,658 (GRCm39) D133G unknown Het
Sdk1 G A 5: 142,130,731 (GRCm39) S1630N probably damaging Het
Sema5b C T 16: 35,467,573 (GRCm39) T279I probably damaging Het
Slc24a3 T A 2: 145,422,902 (GRCm39) L207H probably damaging Het
Speer2 A T 16: 69,654,965 (GRCm39) S167T possibly damaging Het
Spock1 A G 13: 57,583,898 (GRCm39) I339T unknown Het
Srsf6 T A 2: 162,776,636 (GRCm39) S327T unknown Het
Syne1 T A 10: 5,172,266 (GRCm39) E5058D probably benign Het
Tcf19 A G 17: 35,825,428 (GRCm39) V243A probably benign Het
Tspan15 T C 10: 62,029,734 (GRCm39) D122G probably benign Het
Ttc17 C T 2: 94,205,495 (GRCm39) V284M probably damaging Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Uspl1 T A 5: 149,141,082 (GRCm39) C360* probably null Het
Vmn1r181 A C 7: 23,684,356 (GRCm39) S274R probably benign Het
Xrcc5 T C 1: 72,433,132 (GRCm39) probably null Het
Zfp277 C T 12: 40,378,729 (GRCm39) R376H probably damaging Het
Zfp629 T C 7: 127,210,201 (GRCm39) E536G probably benign Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44,396,088 (GRCm39) splice site probably benign
IGL01593:Enpp5 APN 17 44,391,612 (GRCm39) missense probably benign
IGL01654:Enpp5 APN 17 44,392,066 (GRCm39) missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44,391,736 (GRCm39) missense probably benign 0.04
IGL02142:Enpp5 APN 17 44,396,468 (GRCm39) missense probably benign 0.01
IGL02531:Enpp5 APN 17 44,391,843 (GRCm39) missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44,393,766 (GRCm39) missense probably damaging 1.00
Cacao UTSW 17 44,396,467 (GRCm39) missense probably benign 0.00
canola UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44,392,258 (GRCm39) missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44,396,264 (GRCm39) missense probably benign 0.25
R2679:Enpp5 UTSW 17 44,396,279 (GRCm39) missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44,392,027 (GRCm39) missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44,391,871 (GRCm39) makesense probably null
R5152:Enpp5 UTSW 17 44,392,024 (GRCm39) missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44,396,210 (GRCm39) missense probably benign 0.22
R6160:Enpp5 UTSW 17 44,392,259 (GRCm39) missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44,396,467 (GRCm39) missense probably benign 0.00
R6821:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44,391,868 (GRCm39) missense probably benign 0.02
R7393:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44,392,366 (GRCm39) missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44,396,155 (GRCm39) missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44,392,402 (GRCm39) critical splice donor site probably null
R9256:Enpp5 UTSW 17 44,396,414 (GRCm39) missense probably benign 0.00
R9321:Enpp5 UTSW 17 44,393,689 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'
Posted On 2019-10-07