Incidental Mutation 'R7446:Jakmip2'
ID 577328
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock # R7446 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43577325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: D271G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: D271G

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
Olfr1425 A G 19: 12,073,697 *312Q probably null Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCAGCTCTGACATGGTGTG -3'
(R):5'- AGCCAAGGACAGGATCATCTTTTC -3'

Sequencing Primer
(F):5'- ATGAAGCACAGCCCACTTTGTTG -3'
(R):5'- AAGGACAGGATCATCTTTTCCCTGG -3'
Posted On 2019-10-07