Incidental Mutation 'R7446:Jakmip2'
ID 577328
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 045522-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R7446 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43710390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: D271G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: D271G

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,950,441 (GRCm39) D1446G probably benign Het
Adgrg1 A G 8: 95,738,412 (GRCm39) Y635C probably damaging Het
Akr1cl G A 1: 65,055,837 (GRCm39) R222W probably damaging Het
C2 G A 17: 35,094,986 (GRCm39) R250C probably damaging Het
Cdk15 A G 1: 59,328,854 (GRCm39) Y254C probably damaging Het
Celsr1 T C 15: 85,791,874 (GRCm39) T2576A possibly damaging Het
Cfap61 C T 2: 145,995,758 (GRCm39) R1108C probably benign Het
Clca3a1 A G 3: 144,733,188 (GRCm39) S107P possibly damaging Het
Cplane1 A G 15: 8,261,564 (GRCm39) D2460G probably damaging Het
Cpsf1 A G 15: 76,485,950 (GRCm39) S407P probably benign Het
Crisp4 T C 1: 18,192,962 (GRCm39) T252A probably damaging Het
Ctbs A G 3: 146,164,573 (GRCm39) Y242C probably damaging Het
Cul4a A G 8: 13,186,874 (GRCm39) T537A probably benign Het
D930020B18Rik T C 10: 121,503,650 (GRCm39) I275T possibly damaging Het
Dcaf7 T C 11: 105,944,561 (GRCm39) V248A probably benign Het
Def8 T C 8: 124,181,061 (GRCm39) C153R probably damaging Het
Dennd1a A T 2: 37,706,991 (GRCm39) V505D possibly damaging Het
Dpysl5 A C 5: 30,936,231 (GRCm39) D207A probably benign Het
Dync2h1 A T 9: 7,041,720 (GRCm39) S3307R probably benign Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Erf A T 7: 24,945,556 (GRCm39) C72S probably damaging Het
Fastkd3 A T 13: 68,740,079 (GRCm39) H47L unknown Het
Gm5591 C T 7: 38,218,933 (GRCm39) E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 66,992,736 (GRCm39) probably benign Het
Guk1 T C 11: 59,076,850 (GRCm39) T78A probably benign Het
Hephl1 T C 9: 15,009,347 (GRCm39) T82A probably damaging Het
Htra4 A G 8: 25,527,181 (GRCm39) S205P probably benign Het
Krt16 CAGTATCTG C 11: 100,137,610 (GRCm39) probably null Het
Lrp1b T A 2: 41,561,069 (GRCm39) E286V Het
Lrp2 C A 2: 69,262,557 (GRCm39) G4415W probably damaging Het
Lrp2 C T 2: 69,290,018 (GRCm39) R3607H probably damaging Het
Mcph1 A G 8: 18,721,109 (GRCm39) K646E probably benign Het
Mgam T C 6: 40,723,266 (GRCm39) L457P probably damaging Het
Mink1 T A 11: 70,500,455 (GRCm39) S802T probably benign Het
Mrgprb5 C T 7: 47,818,252 (GRCm39) G161E possibly damaging Het
Mroh1 G A 15: 76,336,472 (GRCm39) G1565D possibly damaging Het
Mynn A G 3: 30,661,201 (GRCm39) K51R probably benign Het
Myo1b A G 1: 51,803,065 (GRCm39) F872S possibly damaging Het
Nbas A T 12: 13,443,499 (GRCm39) T1185S probably benign Het
Oas1d A T 5: 121,058,054 (GRCm39) I333L probably benign Het
Or10ak9 A T 4: 118,726,019 (GRCm39) I14F possibly damaging Het
Or4d10 A G 19: 12,051,061 (GRCm39) *312Q probably null Het
P2ry12 A G 3: 59,124,632 (GRCm39) *348Q probably null Het
Pik3cb A T 9: 98,928,711 (GRCm39) V848E probably damaging Het
Plcz1 A C 6: 139,959,312 (GRCm39) S282A possibly damaging Het
Prss46 A G 9: 110,679,189 (GRCm39) D130G probably damaging Het
Pygl T C 12: 70,243,784 (GRCm39) I644V probably benign Het
Ralgds T A 2: 28,435,901 (GRCm39) S509T probably damaging Het
Rdh16f2 A G 10: 127,712,767 (GRCm39) D255G probably benign Het
Scaf4 T C 16: 90,055,658 (GRCm39) D133G unknown Het
Sdk1 G A 5: 142,130,731 (GRCm39) S1630N probably damaging Het
Sema5b C T 16: 35,467,573 (GRCm39) T279I probably damaging Het
Slc24a3 T A 2: 145,422,902 (GRCm39) L207H probably damaging Het
Speer2 A T 16: 69,654,965 (GRCm39) S167T possibly damaging Het
Spock1 A G 13: 57,583,898 (GRCm39) I339T unknown Het
Srsf6 T A 2: 162,776,636 (GRCm39) S327T unknown Het
Syne1 T A 10: 5,172,266 (GRCm39) E5058D probably benign Het
Tcf19 A G 17: 35,825,428 (GRCm39) V243A probably benign Het
Tspan15 T C 10: 62,029,734 (GRCm39) D122G probably benign Het
Ttc17 C T 2: 94,205,495 (GRCm39) V284M probably damaging Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Uspl1 T A 5: 149,141,082 (GRCm39) C360* probably null Het
Vmn1r181 A C 7: 23,684,356 (GRCm39) S274R probably benign Het
Xrcc5 T C 1: 72,433,132 (GRCm39) probably null Het
Zfp277 C T 12: 40,378,729 (GRCm39) R376H probably damaging Het
Zfp629 T C 7: 127,210,201 (GRCm39) E536G probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43,700,209 (GRCm39) missense probably benign
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43,698,995 (GRCm39) missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7515:Jakmip2 UTSW 18 43,704,191 (GRCm39) missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43,704,973 (GRCm39) missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43,696,398 (GRCm39) missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCAGCTCTGACATGGTGTG -3'
(R):5'- AGCCAAGGACAGGATCATCTTTTC -3'

Sequencing Primer
(F):5'- ATGAAGCACAGCCCACTTTGTTG -3'
(R):5'- AAGGACAGGATCATCTTTTCCCTGG -3'
Posted On 2019-10-07