Incidental Mutation 'R7446:Olfr1425'
ID577329
Institutional Source Beutler Lab
Gene Symbol Olfr1425
Ensembl Gene ENSMUSG00000067526
Gene Nameolfactory receptor 1425
SynonymsGA_x6K02T2RE5P-2433425-2432490, MOR239-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7446 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12073234-12077731 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 12073697 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 312 (*312Q)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000214918]
Predicted Effect probably null
Transcript: ENSMUST00000087828
AA Change: *313Q
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: *313Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214918
AA Change: *312Q
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,232,080 D2460G probably damaging Het
4930407I10Rik A G 15: 82,066,240 D1446G probably benign Het
Adgrg1 A G 8: 95,011,784 Y635C probably damaging Het
Akr1cl G A 1: 65,016,678 R222W probably damaging Het
C2 G A 17: 34,876,010 R250C probably damaging Het
Cdk15 A G 1: 59,289,695 Y254C probably damaging Het
Celsr1 T C 15: 85,907,673 T2576A possibly damaging Het
Cfap61 C T 2: 146,153,838 R1108C probably benign Het
Clca1 A G 3: 145,027,427 S107P possibly damaging Het
Cpsf1 A G 15: 76,601,750 S407P probably benign Het
Crisp4 T C 1: 18,122,738 T252A probably damaging Het
Ctbs A G 3: 146,458,818 Y242C probably damaging Het
Cul4a A G 8: 13,136,874 T537A probably benign Het
D930020B18Rik T C 10: 121,667,745 I275T possibly damaging Het
Dcaf7 T C 11: 106,053,735 V248A probably benign Het
Def8 T C 8: 123,454,322 C153R probably damaging Het
Dennd1a A T 2: 37,816,979 V505D possibly damaging Het
Dpysl5 A C 5: 30,778,887 D207A probably benign Het
Dync2h1 A T 9: 7,041,720 S3307R probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Erf A T 7: 25,246,131 C72S probably damaging Het
Fastkd3 A T 13: 68,591,960 H47L unknown Het
Gm5591 C T 7: 38,519,509 E647K probably benign Het
Gng12 TGTCCAGCAAG TG 6: 67,015,752 probably benign Het
Guk1 T C 11: 59,186,024 T78A probably benign Het
Hephl1 T C 9: 15,098,051 T82A probably damaging Het
Htra4 A G 8: 25,037,165 S205P probably benign Het
Jakmip2 T C 18: 43,577,325 D271G probably damaging Het
Krt16 CAGTATCTG C 11: 100,246,784 probably null Het
Lrp1b T A 2: 41,671,057 E286V Het
Lrp2 C A 2: 69,432,213 G4415W probably damaging Het
Lrp2 C T 2: 69,459,674 R3607H probably damaging Het
Mcph1 A G 8: 18,671,093 K646E probably benign Het
Mgam T C 6: 40,746,332 L457P probably damaging Het
Mink1 T A 11: 70,609,629 S802T probably benign Het
Mrgprb5 C T 7: 48,168,504 G161E possibly damaging Het
Mroh1 G A 15: 76,452,272 G1565D possibly damaging Het
Mynn A G 3: 30,607,052 K51R probably benign Het
Myo1b A G 1: 51,763,906 F872S possibly damaging Het
Nbas A T 12: 13,393,498 T1185S probably benign Het
Oas1d A T 5: 120,919,991 I333L probably benign Het
Olfr1331 A T 4: 118,868,822 I14F possibly damaging Het
P2ry12 A G 3: 59,217,211 *348Q probably null Het
Pik3cb A T 9: 99,046,658 V848E probably damaging Het
Plcz1 A C 6: 140,013,586 S282A possibly damaging Het
Prss46 A G 9: 110,850,121 D130G probably damaging Het
Pygl T C 12: 70,197,010 I644V probably benign Het
Ralgds T A 2: 28,545,889 S509T probably damaging Het
Rdh16f2 A G 10: 127,876,898 D255G probably benign Het
Scaf4 T C 16: 90,258,770 D133G unknown Het
Sdk1 G A 5: 142,144,976 S1630N probably damaging Het
Sema5b C T 16: 35,647,203 T279I probably damaging Het
Slc24a3 T A 2: 145,580,982 L207H probably damaging Het
Speer2 A T 16: 69,858,077 S167T possibly damaging Het
Spock1 A G 13: 57,436,085 I339T unknown Het
Srsf6 T A 2: 162,934,716 S327T unknown Het
Syne1 T A 10: 5,222,266 E5058D probably benign Het
Tcf19 A G 17: 35,514,531 V243A probably benign Het
Tspan15 T C 10: 62,193,955 D122G probably benign Het
Ttc17 C T 2: 94,375,150 V284M probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Uspl1 T A 5: 149,204,272 C360* probably null Het
Vmn1r181 A C 7: 23,984,931 S274R probably benign Het
Xrcc5 T C 1: 72,393,973 probably null Het
Zfp277 C T 12: 40,328,730 R376H probably damaging Het
Zfp629 T C 7: 127,611,029 E536G probably benign Het
Other mutations in Olfr1425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Olfr1425 APN 19 12074057 missense probably benign 0.00
IGL02508:Olfr1425 APN 19 12073887 missense possibly damaging 0.90
IGL03183:Olfr1425 APN 19 12074028 missense probably damaging 0.98
R1164:Olfr1425 UTSW 19 12074241 nonsense probably null
R1866:Olfr1425 UTSW 19 12073819 missense probably benign 0.03
R3745:Olfr1425 UTSW 19 12074380 missense probably damaging 1.00
R4364:Olfr1425 UTSW 19 12074497 missense probably benign 0.13
R4888:Olfr1425 UTSW 19 12074315 missense probably damaging 1.00
R4962:Olfr1425 UTSW 19 12074275 missense probably damaging 1.00
R5954:Olfr1425 UTSW 19 12074083 missense possibly damaging 0.96
R6383:Olfr1425 UTSW 19 12074363 missense probably damaging 1.00
R6409:Olfr1425 UTSW 19 12074747 start gained probably benign
R6417:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R6420:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R7109:Olfr1425 UTSW 19 12074212 missense probably benign
R7505:Olfr1425 UTSW 19 12074605 missense possibly damaging 0.88
Z1176:Olfr1425 UTSW 19 12073840 missense probably damaging 1.00
Z1176:Olfr1425 UTSW 19 12073910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAGTTGTTAAGACATGAGTTC -3'
(R):5'- TGCTGAAGTCTCAATCAGGAG -3'

Sequencing Primer
(F):5'- CCATTTGACAGCTTATTGGT -3'
(R):5'- CTGCATCTATGTCTATGCCAGG -3'
Posted On2019-10-07