Incidental Mutation 'R0629:Mroh9'
ID57733
Institutional Source Beutler Lab
Gene Symbol Mroh9
Ensembl Gene ENSMUSG00000071890
Gene Namemaestro heat-like repeat family member 9
Synonyms4921528O07Rik, Armc11
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score214
Status Validated
Chromosome1
Chromosomal Location163024302-163085670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163060636 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 290 (H290R)
Ref Sequence ENSEMBL: ENSMUSP00000094365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096608
AA Change: H290R

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094365
Gene: ENSMUSG00000071890
AA Change: H290R

DomainStartEndE-ValueType
SCOP:d1gw5b_ 231 716 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195132
Meta Mutation Damage Score 0.3092 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Mroh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Mroh9 APN 1 163045781 missense possibly damaging 0.89
IGL00705:Mroh9 APN 1 163079503 missense probably damaging 1.00
IGL00788:Mroh9 APN 1 163024658 missense probably benign 0.06
IGL00795:Mroh9 APN 1 163060622 missense probably damaging 1.00
IGL00815:Mroh9 APN 1 163039131 missense probably damaging 1.00
IGL01025:Mroh9 APN 1 163047866 missense possibly damaging 0.67
IGL01303:Mroh9 APN 1 163080575 missense probably benign 0.00
IGL01526:Mroh9 APN 1 163055603 missense probably damaging 0.99
IGL01680:Mroh9 APN 1 163047982 splice site probably null
IGL01823:Mroh9 APN 1 163055609 missense probably benign 0.39
IGL02024:Mroh9 APN 1 163062502 missense possibly damaging 0.65
IGL02213:Mroh9 APN 1 163058079 missense probably damaging 1.00
IGL02455:Mroh9 APN 1 163075580 missense probably benign 0.03
IGL02546:Mroh9 APN 1 163080576 missense probably benign 0.04
IGL03059:Mroh9 APN 1 163024636 missense possibly damaging 0.95
IGL03061:Mroh9 APN 1 163026502 missense probably damaging 1.00
IGL03071:Mroh9 APN 1 163039197 missense probably damaging 1.00
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0048:Mroh9 UTSW 1 163062487 missense probably damaging 0.97
R0441:Mroh9 UTSW 1 163060762 missense probably damaging 1.00
R0506:Mroh9 UTSW 1 163060636 missense possibly damaging 0.90
R0751:Mroh9 UTSW 1 163066124 missense possibly damaging 0.84
R1301:Mroh9 UTSW 1 163043983 critical splice donor site probably null
R1481:Mroh9 UTSW 1 163026509 missense probably damaging 1.00
R1618:Mroh9 UTSW 1 163024541 missense probably benign 0.00
R1647:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1648:Mroh9 UTSW 1 163046056 missense probably damaging 1.00
R1668:Mroh9 UTSW 1 163024592 missense possibly damaging 0.52
R1795:Mroh9 UTSW 1 163056778 missense probably damaging 0.97
R1796:Mroh9 UTSW 1 163045710 missense probably damaging 1.00
R1857:Mroh9 UTSW 1 163039145 missense probably damaging 0.98
R1869:Mroh9 UTSW 1 163026513 missense probably damaging 0.97
R1923:Mroh9 UTSW 1 163076291 missense probably damaging 1.00
R2325:Mroh9 UTSW 1 163026530 splice site probably null
R2511:Mroh9 UTSW 1 163038945 missense probably benign 0.13
R2912:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2913:Mroh9 UTSW 1 163044003 missense probably damaging 1.00
R2919:Mroh9 UTSW 1 163056772 missense probably damaging 1.00
R2973:Mroh9 UTSW 1 163056769 missense probably damaging 1.00
R3912:Mroh9 UTSW 1 163066069 missense probably damaging 0.97
R4034:Mroh9 UTSW 1 163080553 critical splice donor site probably null
R4551:Mroh9 UTSW 1 163044093 missense probably damaging 0.98
R4656:Mroh9 UTSW 1 163066024 missense probably damaging 1.00
R4662:Mroh9 UTSW 1 163055593 missense probably damaging 0.97
R4743:Mroh9 UTSW 1 163024492 missense probably benign 0.05
R4890:Mroh9 UTSW 1 163026524 missense probably damaging 1.00
R5128:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5129:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5147:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5157:Mroh9 UTSW 1 163044121 missense probably damaging 0.96
R5324:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5325:Mroh9 UTSW 1 163060760 missense probably damaging 1.00
R5340:Mroh9 UTSW 1 163080587 start gained probably benign
R6005:Mroh9 UTSW 1 163075677 missense probably damaging 0.99
R6182:Mroh9 UTSW 1 163066043 nonsense probably null
R6414:Mroh9 UTSW 1 163074702 missense probably damaging 1.00
R6477:Mroh9 UTSW 1 163076304 missense probably damaging 1.00
R6540:Mroh9 UTSW 1 163038972 missense possibly damaging 0.87
R6541:Mroh9 UTSW 1 163058038 missense possibly damaging 0.78
R6643:Mroh9 UTSW 1 163075561 missense probably damaging 1.00
R6811:Mroh9 UTSW 1 163046041 missense possibly damaging 0.86
R6830:Mroh9 UTSW 1 163076366 missense probably benign
R7026:Mroh9 UTSW 1 163060682 missense probably benign 0.00
R7052:Mroh9 UTSW 1 163038956 missense possibly damaging 0.92
R7068:Mroh9 UTSW 1 163039181 missense probably damaging 1.00
R7350:Mroh9 UTSW 1 163076289 critical splice donor site probably null
R7545:Mroh9 UTSW 1 163074708 missense possibly damaging 0.56
R7615:Mroh9 UTSW 1 163046032 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGTGCAACTTCAAGCTGAGAGTCC -3'
(R):5'- TGTCCAGAGCATCCCCTAAAGTGTC -3'

Sequencing Primer
(F):5'- CTTCAAGCTGAGAGTCCTTGAAAATG -3'
(R):5'- GCATCCCCTAAAGTGTCTAAGATTTG -3'
Posted On2013-07-11