Incidental Mutation 'R7447:Axdnd1'
ID 577331
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 156245802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000179744] [ENSMUST00000179985] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000177824
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178036
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179744
Predicted Effect probably benign
Transcript: ENSMUST00000179985
Predicted Effect probably null
Transcript: ENSMUST00000213088
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A T 15: 76,479,396 (GRCm39) I484F possibly damaging Het
Ago2 A T 15: 73,009,881 (GRCm39) N100K probably benign Het
Appl1 T A 14: 26,681,409 (GRCm39) K130* probably null Het
Arhgap39 G A 15: 76,649,797 (GRCm39) probably benign Het
Camta1 A T 4: 151,168,327 (GRCm39) V1332E probably benign Het
Cd3g A G 9: 44,884,857 (GRCm39) L129P probably damaging Het
Cd80 T G 16: 38,294,251 (GRCm39) S45A probably benign Het
Cdk12 A T 11: 98,136,106 (GRCm39) Q1120L unknown Het
Clip1 G A 5: 123,791,696 (GRCm39) S158F probably benign Het
Cntn3 C A 6: 102,255,416 (GRCm39) E161* probably null Het
Cyp3a59 A C 5: 146,024,215 (GRCm39) K67T probably benign Het
Dmxl1 T C 18: 49,997,681 (GRCm39) L623P probably damaging Het
Drd3 T A 16: 43,637,426 (GRCm39) Y208* probably null Het
Dusp10 A T 1: 183,801,153 (GRCm39) M307L probably benign Het
Dync2li1 A T 17: 84,955,141 (GRCm39) I267L possibly damaging Het
Dynlt2b T A 16: 32,244,089 (GRCm39) V95E probably damaging Het
Edn3 C A 2: 174,603,544 (GRCm39) C97* probably null Het
Ehbp1l1 T A 19: 5,769,456 (GRCm39) T616S possibly damaging Het
Eif2a C T 3: 58,452,963 (GRCm39) T246I probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Errfi1 A G 4: 150,951,108 (GRCm39) T179A probably damaging Het
Esyt3 G A 9: 99,203,615 (GRCm39) L450F probably damaging Het
Evx2 A G 2: 74,489,448 (GRCm39) S106P probably benign Het
Fam83a T G 15: 57,873,086 (GRCm39) V305G probably benign Het
Fem1al T C 11: 29,774,122 (GRCm39) D445G probably benign Het
Gpr171 T A 3: 59,005,860 (GRCm39) probably null Het
Grip1 A G 10: 119,922,871 (GRCm39) T1106A probably benign Het
Hecw1 A G 13: 14,531,789 (GRCm39) Y162H probably damaging Het
Hephl1 C T 9: 15,009,178 (GRCm39) probably null Het
Hsp90aa1 A G 12: 110,658,562 (GRCm39) I693T possibly damaging Het
Ifit1bl2 T A 19: 34,596,974 (GRCm39) D214V probably damaging Het
Igsf10 T C 3: 59,239,222 (GRCm39) M320V probably benign Het
Kcnq2 A G 2: 180,754,887 (GRCm39) L220P probably damaging Het
Kpna1 C A 16: 35,850,009 (GRCm39) Q372K probably damaging Het
Lilrb4a T G 10: 51,367,149 (GRCm39) probably null Het
Ly75 C A 2: 60,164,818 (GRCm39) E787* probably null Het
Magi1 T G 6: 93,722,562 (GRCm39) S666R possibly damaging Het
Mif C A 10: 75,695,687 (GRCm39) A39S possibly damaging Het
Mob4 G A 1: 55,170,625 (GRCm39) probably benign Het
Mtmr4 G T 11: 87,502,727 (GRCm39) C927F probably damaging Het
Myh1 A G 11: 67,110,006 (GRCm39) K1398R probably benign Het
Myo3a T C 2: 22,436,464 (GRCm39) V873A probably benign Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nckap5l G A 15: 99,325,357 (GRCm39) P382L probably damaging Het
Ngly1 T C 14: 16,290,844 (GRCm38) I442T probably damaging Het
Nhsl3 C A 4: 129,115,835 (GRCm39) R988L possibly damaging Het
Nlrp1a T C 11: 70,983,237 (GRCm39) Y1243C probably damaging Het
Or8k53 T A 2: 86,177,150 (GRCm39) H320L possibly damaging Het
Pcsk5 C T 19: 17,487,600 (GRCm39) G1027D probably benign Het
Pla2g2c T A 4: 138,458,927 (GRCm39) I11N probably benign Het
Polr3d A G 14: 70,677,240 (GRCm39) I331T probably damaging Het
Ppp4r4 A G 12: 103,551,985 (GRCm39) I293M possibly damaging Het
Prkce G T 17: 86,866,687 (GRCm39) V516F probably damaging Het
Prss27 T A 17: 24,264,683 (GRCm39) L282Q probably damaging Het
Pxdn A G 12: 30,034,926 (GRCm39) Y261C probably damaging Het
R3hcc1l T C 19: 42,551,101 (GRCm39) S33P probably benign Het
Rab11fip3 G C 17: 26,287,848 (GRCm39) R102G possibly damaging Het
Rabggta A T 14: 55,956,773 (GRCm39) N310K probably null Het
Rbbp8 T A 18: 11,793,934 (GRCm39) D15E probably benign Het
Rbm5 T C 9: 107,623,378 (GRCm39) Y486C probably damaging Het
Rptor T A 11: 119,775,805 (GRCm39) F992Y probably benign Het
Slc29a2 T G 19: 5,076,445 (GRCm39) L111R probably damaging Het
Slc39a11 T A 11: 113,452,849 (GRCm39) I31L probably benign Het
Slc6a20a T A 9: 123,485,289 (GRCm39) N311I possibly damaging Het
Slc8a1 A G 17: 81,956,435 (GRCm39) F201S probably damaging Het
Smtn C A 11: 3,480,196 (GRCm39) V342L probably benign Het
Syne2 A G 12: 76,074,853 (GRCm39) T4598A probably benign Het
Tchp A G 5: 114,853,716 (GRCm39) T267A probably benign Het
Tes3-ps A G 13: 49,647,508 (GRCm39) E128G possibly damaging Het
Tigar C T 6: 127,065,129 (GRCm39) G173E probably benign Het
Tmem171 T C 13: 98,824,862 (GRCm39) N256S probably benign Het
Tmem204 A G 17: 25,277,270 (GRCm39) I205T probably damaging Het
Tmem63a A G 1: 180,785,588 (GRCm39) K240R probably benign Het
Tns2 C T 15: 102,019,351 (GRCm39) T446M probably damaging Het
Tnxb A T 17: 34,937,444 (GRCm39) N2931I probably damaging Het
Trrap G T 5: 144,776,284 (GRCm39) R2941L probably damaging Het
Ttc8 A T 12: 98,910,131 (GRCm39) R179S probably damaging Het
Ttll12 G T 15: 83,471,176 (GRCm39) T234N probably damaging Het
Ttn G T 2: 76,577,576 (GRCm39) T24439K probably damaging Het
Ube2z A T 11: 95,946,736 (GRCm39) I246N possibly damaging Het
Usp15 A G 10: 123,011,786 (GRCm39) Y104H probably damaging Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp5 G A 6: 124,798,077 (GRCm39) A436V probably damaging Het
Utp20 A G 10: 88,608,354 (GRCm39) L1561S probably damaging Het
Xrn1 A G 9: 95,927,547 (GRCm39) M1444V probably benign Het
Zfp236 G T 18: 82,651,815 (GRCm39) Q885K probably damaging Het
Zfp831 C A 2: 174,487,896 (GRCm39) P857Q possibly damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2126:Axdnd1 UTSW 1 156,160,784 (GRCm39) missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156,208,383 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8348:Axdnd1 UTSW 1 156,245,854 (GRCm39) missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156,219,516 (GRCm39) missense
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9294:Axdnd1 UTSW 1 156,247,917 (GRCm39) nonsense probably null
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTTAATTCGGAGCACAGC -3'
(R):5'- TACGCATTCTGCTCCTCTATAAAGC -3'

Sequencing Primer
(F):5'- GGAGCACAGCCTCCACTTC -3'
(R):5'- CTGCTCCTCTATAAAGCATCTAAATG -3'
Posted On 2019-10-07